ROUGE |
Gene/Protein Characteristic Table for mKIAA4129 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220499 |
---|---|
BAI1-associated protein 1. guanylate kinase membrane-associated inverted 1. |
|
mfj49110 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4229 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 849 bp Genome contig ID gi65504368r_94036032 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GAGATTCTTGTTTAAAATTTAAAAAACAAAAAAACFlanking genome sequence
(99985 - 99936) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAGGAAGCTATGCCCTAGATGTAGGGCTTTTTTTCCCAAC
Features of the protein sequence |
Description | |
Coding region: 3..3377
Length: 1125 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |