ROUGE |
Gene/Protein Characteristic Table for mKIAA0472 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172954 |
---|---|
dusty protein kinase. | |
mbh01581 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5185 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2402 bp Genome contig ID gi65488608f_132174937 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GCCTGCACATGGCCTTGGGTTCAGTGTCTAGAACCFlanking genome sequence
(148251 - 148300) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAGCCACAAAGGTCAAAGGGGTTGGAATGTTTT
KIAA Alignment based on: KIAA0472 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 807..2783
Length: 658 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |