ROUGE

Gene/Protein Characteristic Table for mKIAA1477

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173181
Description :	MAP/microtubule affinity-regulating kinase 1. ELKL motif serine-threonine protein kinase 3.
Clone Name :	mfj36325 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4044 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1726 bp

Genome contig ID gi65488608r_184295247
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
AGGCCTCATAATAAAGCGTTTGTCTTTGGCTCTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTCGAGCTGTGAATCACCTGTTTGCTGCTTGGAGAGCCCTCCGAGTGCGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1477 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1477	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2318
Length: 771 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL13075	99.5	MAP/microtubule...	Mus musculus
AAI12401	99.5	Mark1 protein [...	Mus musculus
Q8VHJ5	98.2	Serine/threonin...	Mus musculus
O08678	96.8	Serine/threonin...	Rattus norvegicus
XP_536123	94.4	similar to Seri...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220191	1.2e-74	69.2	mKIAA4207
AK220557	1.9e-67	89.2	mKIAA4230
AK122565	2.6e-56	52.2	mKIAA1860
AK220203	5.5e-29	37.4	mFLJ00263
BC020189	3.8e-28	30.0	mKIAA0096

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 35 286 PD000001 Protein kinase

HMMPfam NULL 35 284 PF07714 NULL

IPR000719 35 286 PF00069 Protein kinase

IPR000449 306 345 PF00627 Ubiquitin-associated

IPR001772 722 771 PF02149 Kinase-associated

HMMSmart IPR002290 35 286 SM00220 Serine/threonine protein kinase

IPR001245 35 285 SM00219 Tyrosine protein kinase

IPR000449 307 344 SM00165 Ubiquitin-associated

ProfileScan IPR000719 35 286 PS50011 Protein kinase

IPR000449 305 345 PS50030 Ubiquitin-associated

IPR001772 722 771 PS50032 Kinase-associated

ScanRegExp IPR000719 41 64 PS00107 Protein kinase

IPR008271 153 165 PS00108 Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	35	286	PD000001	Protein kinase
HMMPfam	NULL	35	284	PF07714	NULL
IPR000719	35	286	PF00069	Protein kinase
IPR000449	306	345	PF00627	Ubiquitin-associated
IPR001772	722	771	PF02149	Kinase-associated
HMMSmart	IPR002290	35	286	SM00220	Serine/threonine protein kinase
IPR001245	35	285	SM00219	Tyrosine protein kinase
IPR000449	307	344	SM00165	Ubiquitin-associated
ProfileScan	IPR000719	35	286	PS50011	Protein kinase
IPR000449	305	345	PS50030	Ubiquitin-associated
IPR001772	722	771	PS50032	Kinase-associated
ScanRegExp	IPR000719	41	64	PS00107	Protein kinase
IPR008271	153	165	PS00108	Serine/threonine protein kinase

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1726 bp
Genome contig ID	gi65488608r_184295247
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- AGGCCTCATAATAAAGCGTTTGTCTTTGGCTCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTCGAGCTGTGAATCACCTGTTTGCTGCTTGGAGAGCCCTCCGAGTGCGT

Gene/Protein Characteristic Table for mKIAA1477

Features of the cloned DNA sequence

Features of the protein sequence