Gene/Protein Characteristic Table for mKIAA0344

Length: 5030 bp

Restriction map

Length of 3'UTR	2403 bp
Genome contig ID	gi65504368r_120286076
PolyA signal sequence (None)	+----*----+----*----+----*----+---- GAGTGTCAGTAACAATAACAAAAGTTGAAAGTCTT
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAGAATGGAAGACTGGGCATAGTACTGTGTGCTTTGATC

KIAA	Alignment based on:
KIAA0344	DNA sequence, AA sequence, Physical map

Coding region: 225..2627

Length: 800 aa

Entry Exp ID% Protein Source EDK99629 0 99.9 WNK lysine defi... Mus musculus P83741 0 99.9 Serine/threonin... Mus musculus AAI38446 0 100.0 Wnk1 protein [M... Mus musculus AAI45283 0 100.0 Wnk1 protein [M... Mus musculus AAS45192 0 98.9 protein kinase ... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK173181 1.3e-07 22.3 mKIAA1477 AK122218 2.2e-07 22.3 mKIAA0204 AK173292 3e-07 25.7 mKIAA1901 AK129298 2.6e-06 25.5 mKIAA1142 AK220528 3.2e-06 31.1 mKIAA4182

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	239	491	PD000001	Protein kinase
HMMPfam	NULL	233	491	PF07714	NULL
	IPR000719	233	491	PF00069	Protein kinase
HMMSmart	IPR002290	233	491	SM00220	Serine/threonine protein kinase
	IPR001245	233	491	SM00219	Tyrosine protein kinase
ProfileScan	IPR000719	233	491	PS50011	Protein kinase
	NULL	583	795	PS50322	NULL
ScanRegExp	IPR008271	357	369	PS00108	Serine/threonine protein kinase

Method	From	To	amino acid sequence
-	-	-	-