KIAA0472

Product ID	ORK06659
Accession No	AB007941
Description	dual serine/threonine and tyrosine protein kinase
Clone name	hh00171
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5494 bp) Predicted protein sequence (365 aa)
Source	Human adult brain
Rouge ID	mKIAA0472 by Kazusa Mouse cDNA Project

Length: 5494 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4394 bp
Genome contig ID	gi89161185r_203279136
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCAGCAGAGCAAGACTCCATCTC
Flanking genome sequence (99780 - 99731)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGAAAAAGAAAAAGAAGGTTAATCCTTCAGTTATGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	203378916	203397914	8	99.1	Perfect prediction

Length: 365 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6XUX3	2.7e-152	100.0	Receptor-intera...	Homo sapiens
AAH72406	2.7e-152	100.0	Receptor intera...	Homo sapiens
Q4VSN5	5.6e-152	99.7	Receptor-intera...	Pan troglodytes
ABD72471	1e-151	99.5	dusty protein k...	Macaca mulatta
NP_001035038	1e-151	99.5	receptor intera...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051547	5.9e-09	25.2	KIAA1760
AB033090	8.9e-09	30.5	KIAA1264
AB032968	1.1e-08	28.1	KIAA1142
AB037782	1.3e-08	28.0	KIAA1361
AB033104	1.5e-08	27.3	KIAA1278

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	153	333	PD000001	Protein kinase
HMMPfam	IPR000719	88	333	PF00069	Protein kinase
HMMSmart	IPR001245	88	342	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	88	342	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	88	342	PS50011	Protein kinase
ScanRegExp	IPR000719	94	117	PS00107	Protein kinase
ScanRegExp	IPR008271	209	221	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	262	DNSVDVYAFGILFWYICSGSVKL	284	PRIMARY	23

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	GGTTGTTAATCCCACTCTGAC
Primer_r	GCTTGCTTTGGAGAGATGATG
PCR product length	99 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles