Gene/Protein Characteristic Table for mKIAA4088

Length: 2817 bp

Restriction map

Length of 3'UTR	852 bp
Genome contig ID	gi65488608f_132072995
PolyA signal sequence (None)	+----*----+----*----+----*----+---- AGGCTGGCCACCCTCCCTCATCTTCATCTGTGGCC
Flanking genome sequence (117096 - 117145)	----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAAAAAAAAACAACCCTCATTAAAACCAGCAGTGGTAA

Coding region: 7..1962

Length: 652 aa

Entry Exp ID% Protein Source BAB23518 0 100.0 unnamed protein... Mus musculus AAH33302 0 99.8 Nuak2 protein [... Mus musculus Q8BZN4 0 98.7 NUAK family SNF... Mus musculus BAC28575 0 98.6 unnamed protein... Mus musculus Q66HE5 0 94.3 NUAK family SNF... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AB182364 3.5e-55 55.8 mKIAA0537 AK220191 9e-34 33.5 mKIAA4207 AK173181 1.3e-32 36.6 mKIAA1477 AK220557 2.9e-32 48.2 mKIAA4230 AK122565 6.4e-27 33.2 mKIAA1860

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	78	316	PD000001	Protein kinase
HMMPfam	NULL	78	326	PF07714	NULL
	IPR000719	78	328	PF00069	Protein kinase
	IPR000687	91	240	PF01163	Protein of unknown function RIO1
HMMSmart	IPR002290	78	328	SM00220	Serine/threonine protein kinase
	IPR001245	78	326	SM00219	Tyrosine protein kinase
ProfileScan	IPR000719	78	328	PS50011	Protein kinase
ScanRegExp	IPR000719	84	110	PS00107	Protein kinase
	IPR008271	196	208	PS00108	Serine/threonine protein kinase

Method	From	To	amino acid sequence
-	-	-	-