ROUGE

Gene/Protein Characteristic Table for mKIAA0249

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220156
Description :	Lipin 2.
Clone Name :	mph01493 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 3194 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2845 bp

Genome contig ID gi65550231f_68917809
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AAAAAAATGTTACAATAATAAACTAACATAAACTG
Flanking genome sequence
(104684 - 104733)
----+----*----+----*----+----*----+----*----+----*
ATTGCATTGGGCTCCTTCCTTCAGGGACTTTGACCGTATCAGTGCCAGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0249 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0249	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..349
Length: 115 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAG52761	9.8e-51	100.0	LPIN2 [Mus musc...	Mus musculus
Q99PI5	9.8e-51	100.0	Lipin-2.	Mus musculus
EDL38377	1e-50	100.0	lipin 2, isofor...	Mus musculus
BAC34088	1.3e-50	99.1	unnamed protein...	Mus musculus
EDL90950	3.8e-50	98.3	lipin 2 (predic...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AB093214	8.3e-30	61.7	mKIAA0188
AK220228	3.6e-28	58.3	mKIAA4023

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]
Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam NULL 1 60 PF08235 NULL
Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	NULL	1	60	PF08235	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2845 bp
Genome contig ID	gi65550231f_68917809
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AAAAAAATGTTACAATAATAAACTAACATAAACTG
Flanking genome sequence (104684 - 104733)	----+--------+--------+--------+--------+----* ATTGCATTGGGCTCCTTCCTTCAGGGACTTTGACCGTATCAGTGCCAGAG

Gene/Protein Characteristic Table for mKIAA0249

Features of the cloned DNA sequence

Features of the protein sequence