ROUGE |
Gene/Protein Characteristic Table for mKIAA4023 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220228 |
---|---|
Lipin 3. | |
msh07169 [Vector Info] | |
Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3470 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 595 bp Genome contig ID gi66880554f_160237640 PolyA signal sequence
(ATTAAA,-19) +----*----+----*----+----*----+----
CAACACGAGGAACGGTATTAAAGAATCACAACTTTFlanking genome sequence
(125329 - 125378) ----+----*----+----*----+----*----+----*----+----*
AAGAAGGTTGAGAACCACGGTCCTTGATGTATCATCTGGGAAGACGACTT
Features of the protein sequence |
Description | |
Coding region: 209..2872
Length: 888 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |