ROUGE

Gene/Protein Characteristic Table for mKIAA0188

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093214
Description :	Lipin 1.
Clone Name :	mtj00866 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 3390 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1333 bp

Genome contig ID gi65532617r_15803102
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TAAATTTCATTGTTAGGGTCAGAGGAGACAGGAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAGGAAAAGATAGAAAGAAGAGTTAAAAAAGAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0188 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0188	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2057
Length: 684 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q91ZP3	99.9	Lipin-1; Fatty ...	Mus musculus
EDK98474	99.9	lipin 1, isofor...	Mus musculus
BAB29412	99.9	unnamed protein...	Mus musculus
AAH42462	99.7	Lpin1 protein [...	Mus musculus
AAH83651	96.3	Lipin 1 [Rattus...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220228	5.2e-75	46.4	mKIAA4023
AK220156	5.5e-19	61.7	mKIAA0249

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam NULL 468 624 PF08235 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	NULL	468	624	PF08235	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1333 bp
Genome contig ID	gi65532617r_15803102
PolyA signal sequence (None)	+--------+--------+----*----+---- TAAATTTCATTGTTAGGGTCAGAGGAGACAGGAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAGGAAAAGATAGAAAGAAGAGTTAAAAAAGAA

Gene/Protein Characteristic Table for mKIAA0188

Features of the cloned DNA sequence

Features of the protein sequence