KIAA0249

Product ID	ORK01967
Accession No	D87436
Description	lipin 2
Clone name	ha07006
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6219 bp) Predicted protein sequence (902 aa)
HaloTag ORF Clone	FHC01967
Flexi ORF Clone	FXC01967
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0249 by Kazusa Mouse cDNA Project

Length: 6219 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3289 bp
Genome contig ID	gi51511735r_2807000
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAACAAAATGTTACAACAATAAACGAACATAACAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTGAATGCATTTGGCTCTTTTCTTCAGGGGACATTGAAACCATCTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	r	2907000	3001945	20	99.4	Perfect prediction

Length: 902 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92539	100.0	Lipin-2.	Homo sapiens
XP_001146228	99.4	lipin 2 isoform...	Pan troglodytes
XP_512044	99.6	lipin 2 isoform...	Pan troglodytes
XP_001085817	98.6	lipin 2 isoform...	Macaca mulatta
XP_001085702	98.7	lipin 2 isoform...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D80010	1.1e-91	51.5	KIAA0188

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007651	7	120	PF04571	Lipin
HMMPfam	IPR013209	691	847	PF08235	LNS2
HMMSmart	IPR013209	691	847	SM00775	LNS2

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TTCCCGTGTTGTAGAGCTTCC
Primer_r	CACTGCACCAAAATATTAGCC
PCR product length	305 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles