ROUGE |
Gene/Protein Characteristic Table for mFLJ00123 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC041780 |
---|---|
tripartite motif-containing 41. | |
msj07117 [Vector Info] | |
Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2315 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 841 bp Genome contig ID gi65527427r_48459268 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
TTGTGTTGCAAAAATAAAAAAAAGTGTTTATTTGCFlanking genome sequence
(99974 - 99925) ----+----*----+----*----+----*----+----*----+----*
TTTTTTTGTGGACTCTTTTAAAAGCAAAGCAGAGATTGTTTTTCAGACCT
KIAA Alignment based on: FLJ00123 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1474
Length: 490 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |