| ROUGE |
Gene/Protein Characteristic Table for mKIAA0129 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK172895 |
|---|---|
| PU.1 binding protein Pub. | |
| msh25292 [Vector Info] | |
| Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3176 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1813 bp Genome contig ID gi65493515r_46321002 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
GCTTTGTTTAATAAAATAGGAATACTGTTCCTTGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACTGTGTTCTTCGTTGGAAGTCAAGTGCATAGCATTCGGACTTGGATAA
KIAA Alignment based on: KIAA0129 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1363
Length: 453 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |