HUGE |
Gene/Protein Characteristic Table for KIAA2029 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04042 |
---|---|
Accession No. : | AB095949 |
Description : | ADAMTS-16 precursor. |
HUGO Gene Name : | |
Clone Name : | pj01256 [Vector Info] |
Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4234 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1166 bp Genome contig ID gi51511721f_5135263 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
GAAGTTTTATAATAAAGTTTATATGGTACAGTGTGFlanking genome sequence
(238156 - 238205) ----+----*----+----*----+----*----+----*----+----*
CTTCTGAACTACCTCATGATTCTTCACAAGGTTTGTTTCTGAAATCAAAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 f 5235263 5373417 20 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1021 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR013273 | 392 | 410 | PR01857 | Peptidase M12B |
IPR013273 | 503 | 522 | PR01857 | Peptidase M12B | |
IPR013273 | 523 | 542 | PR01857 | Peptidase M12B | |
HMMPfam | IPR001590 | 89 | 292 | PF01421 | Peptidase M12B |
IPR000884 | 387 | 437 | PF00090 | Thrombospondin | |
IPR010294 | 543 | 655 | PF05986 | ADAM-TS Spacer 1 | |
IPR000884 | 731 | 783 | PF00090 | Thrombospondin | |
IPR000884 | 790 | 844 | PF00090 | Thrombospondin | |
IPR000884 | 852 | 898 | PF00090 | Thrombospondin | |
IPR000884 | 925 | 977 | PF00090 | Thrombospondin | |
IPR010909 | 986 | 1018 | PF08686 | PLAC | |
HMMSmart | IPR000884 | 386 | 438 | SM00209 | Thrombospondin |
IPR000884 | 671 | 720 | SM00209 | Thrombospondin | |
IPR000884 | 727 | 784 | SM00209 | Thrombospondin | |
IPR000884 | 786 | 845 | SM00209 | Thrombospondin | |
IPR000884 | 851 | 912 | SM00209 | Thrombospondin | |
IPR000884 | 926 | 978 | SM00209 | Thrombospondin | |
ProfileScan | IPR001590 | 87 | 292 | PS50215 | Peptidase M12B |
IPR000884 | 383 | 438 | PS50092 | Thrombospondin | |
IPR000884 | 724 | 784 | PS50092 | Thrombospondin | |
IPR000884 | 785 | 845 | PS50092 | Thrombospondin | |
IPR000884 | 848 | 912 | PS50092 | Thrombospondin | |
IPR000884 | 924 | 978 | PS50092 | Thrombospondin | |
IPR010909 | 983 | 1020 | PS50900 | PLAC | |
ScanRegExp | IPR006130 | 421 | 428 | PS00097 | Aspartate/ornithine carbamoyltransferase |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AACTCAGCCTGCACGATTCAC | |
: CAGTGCCCATTCAGGTAGTAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |