HUGE

Gene/Protein Characteristic Table for KIAA2029

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04042
Accession No. :	AB095949
Description :	ADAMTS-16 precursor.
HUGO Gene Name :
Clone Name :	pj01256 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 4234 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1166 bp

Genome contig ID gi51511721f_5135263
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
GAAGTTTTATAATAAAGTTTATATGGTACAGTGTG
Flanking genome sequence
(238156 - 238205)
----+----*----+----*----+----*----+----*----+----*
CTTCTGAACTACCTCATGATTCTTCACAAGGTTTGTTTCTGAAATCAAAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 5235263 5373417 20 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1021 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI40298	99.9	ADAM metallopep...	synthetic construct
Q8TE57	99.9	A disintegrin a...	Homo sapiens
XP_001082662	98.3	ADAM metallopep...	Macaca mulatta
XP_545184	88.1	similar to ADAM...	Canis lupus fam...
XP_001501379	88.0	similar to ADAM...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037733	5.6e-82	33.3	KIAA1312
AB002364	4.9e-60	33.6	KIAA0366
AB037767	4.2e-44	35.0	KIAA1346
AB014588	1.7e-34	35.6	KIAA0688
AB011177	8.8e-28	25.0	KIAA0605

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR013273 392 410 PR01857 Peptidase M12B

IPR013273 503 522 PR01857 Peptidase M12B

IPR013273 523 542 PR01857 Peptidase M12B

HMMPfam IPR001590 89 292 PF01421 Peptidase M12B

IPR000884 387 437 PF00090 Thrombospondin

IPR010294 543 655 PF05986 ADAM-TS Spacer 1

IPR000884 731 783 PF00090 Thrombospondin

IPR000884 790 844 PF00090 Thrombospondin

IPR000884 852 898 PF00090 Thrombospondin

IPR000884 925 977 PF00090 Thrombospondin

IPR010909 986 1018 PF08686 PLAC

HMMSmart IPR000884 386 438 SM00209 Thrombospondin

IPR000884 671 720 SM00209 Thrombospondin

IPR000884 727 784 SM00209 Thrombospondin

IPR000884 786 845 SM00209 Thrombospondin

IPR000884 851 912 SM00209 Thrombospondin

IPR000884 926 978 SM00209 Thrombospondin

ProfileScan IPR001590 87 292 PS50215 Peptidase M12B

IPR000884 383 438 PS50092 Thrombospondin

IPR000884 724 784 PS50092 Thrombospondin

IPR000884 785 845 PS50092 Thrombospondin

IPR000884 848 912 PS50092 Thrombospondin

IPR000884 924 978 PS50092 Thrombospondin

IPR010909 983 1020 PS50900 PLAC

ScanRegExp IPR006130 421 428 PS00097 Aspartate/ornithine carbamoyltransferase

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR013273	392	410	PR01857	Peptidase M12B
IPR013273	503	522	PR01857	Peptidase M12B
IPR013273	523	542	PR01857	Peptidase M12B
HMMPfam	IPR001590	89	292	PF01421	Peptidase M12B
IPR000884	387	437	PF00090	Thrombospondin
IPR010294	543	655	PF05986	ADAM-TS Spacer 1
IPR000884	731	783	PF00090	Thrombospondin
IPR000884	790	844	PF00090	Thrombospondin
IPR000884	852	898	PF00090	Thrombospondin
IPR000884	925	977	PF00090	Thrombospondin
IPR010909	986	1018	PF08686	PLAC
HMMSmart	IPR000884	386	438	SM00209	Thrombospondin
IPR000884	671	720	SM00209	Thrombospondin
IPR000884	727	784	SM00209	Thrombospondin
IPR000884	786	845	SM00209	Thrombospondin
IPR000884	851	912	SM00209	Thrombospondin
IPR000884	926	978	SM00209	Thrombospondin
ProfileScan	IPR001590	87	292	PS50215	Peptidase M12B
IPR000884	383	438	PS50092	Thrombospondin
IPR000884	724	784	PS50092	Thrombospondin
IPR000884	785	845	PS50092	Thrombospondin
IPR000884	848	912	PS50092	Thrombospondin
IPR000884	924	978	PS50092	Thrombospondin
IPR010909	983	1020	PS50900	PLAC
ScanRegExp	IPR006130	421	428	PS00097	Aspartate/ornithine carbamoyltransferase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AACTCAGCCTGCACGATTCAC

Primer_r
: CAGTGCCCATTCAGGTAGTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1166 bp
Genome contig ID	gi51511721f_5135263
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GAAGTTTTATAATAAAGTTTATATGGTACAGTGTG
Flanking genome sequence (238156 - 238205)	----+--------+--------+--------+--------+----* CTTCTGAACTACCTCATGATTCTTCACAAGGTTTGTTTCTGAAATCAAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	5235263	5373417	20	100.0	Perfect prediction

Primer_f	: AACTCAGCCTGCACGATTCAC
Primer_r	: CAGTGCCCATTCAGGTAGTAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA2029

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information