HUGE |
Gene/Protein Characteristic Table for KIAA1346 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00218 |
---|---|
Accession No. : | AB037767 |
Description : | ADAMTS-1 precursor. |
HUGO Gene Name : | ADAM metallopeptidase with thrombospondin type 1 motif, 1 (ADAMTS1) |
Clone Name : | fj00671 [Vector Info] |
Flexi ORF Clone : | pF1KA1346
![]() |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4309 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1290 bp Genome contig ID gi51511750r_27030479 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
AATATATGTTACTAGAAATAAAAGAACACTTTTGGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATGTGTGTGTCTGTTTTTTGAAGTGGGAATTCATTCCTAGGAAGGAAAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 21 r 27130479 27139259 9 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 999 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR013274 | 33 | 51 | PR01858 | Peptidase M12B |
IPR013274 | 134 | 145 | PR01858 | Peptidase M12B | |
IPR013274 | 196 | 208 | PR01858 | Peptidase M12B | |
IPR013274 | 226 | 240 | PR01858 | Peptidase M12B | |
IPR013274 | 345 | 356 | PR01858 | Peptidase M12B | |
IPR013273 | 600 | 618 | PR01857 | Peptidase M12B | |
IPR013274 | 646 | 655 | PR01858 | Peptidase M12B | |
IPR013273 | 717 | 736 | PR01857 | Peptidase M12B | |
IPR013273 | 737 | 756 | PR01857 | Peptidase M12B | |
IPR013274 | 959 | 975 | PR01858 | Peptidase M12B | |
HMMPfam | IPR002870 | 66 | 205 | PF01562 | Peptidase M12B |
IPR001590 | 290 | 499 | PF01421 | Peptidase M12B | |
IPR000884 | 595 | 645 | PF00090 | Thrombospondin | |
IPR010294 | 757 | 875 | PF05986 | ADAM-TS Spacer 1 | |
IPR000884 | 888 | 941 | PF00090 | Thrombospondin | |
IPR000884 | 947 | 998 | PF00090 | Thrombospondin | |
HMMSmart | IPR006586 | 500 | 580 | SM00608 | ADAM |
IPR000884 | 594 | 646 | SM00209 | Thrombospondin | |
IPR000884 | 889 | 942 | SM00209 | Thrombospondin | |
IPR000884 | 943 | 999 | SM00209 | Thrombospondin | |
ProfileScan | IPR001590 | 290 | 499 | PS50215 | Peptidase M12B |
IPR000884 | 591 | 646 | PS50092 | Thrombospondin | |
IPR000884 | 886 | 937 | PS50092 | Thrombospondin | |
IPR000884 | 940 | 999 | PS50092 | Thrombospondin | |
ScanRegExp | IPR006025 | 430 | 439 | PS00142 | Peptidase M |
IPR001128 | 524 | 533 | PS00086 | Cytochrome P450 |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CCCTGTTTCCTGGTACTTATC | |
: CCATAGCAGCCATAAACAGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 21 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |