ROUGE

Gene/Protein Characteristic Table for mKIAA2029

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173338
Description :	a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16. a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16 preproprotein.
Clone Name :	meh00056 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 4904 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1038 bp

Genome contig ID gi65535943r_66679512
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TATTTGCTGAAGTTTTATAATAAATTTTATATTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGGTGTGCTTTGGAACCACTTCATGGTTTTTTCATGAGGTCTACTGCTG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA2029 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA2029	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 165..3866
Length: 1233 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q69Z28	100.0	A disintegrin a...	Mus musculus
Q8TE57	83.0	A disintegrin a...	Homo sapiens
XP_001082662	83.3	ADAM metallopep...	Macaca mulatta
AAI40298	82.9	ADAM metallopep...	synthetic construct
XP_001501379	79.7	similar to ADAM...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220464	2.1e-61	32.9	mKIAA4060
BC050834	1.6e-55	33.8	mKIAA1346
AK173001	6.8e-38	33.3	mKIAA0688
AK172978	3.2e-12	29.6	mKIAA0605
AK220376	3.9e-12	28.7	mKIAA1233

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002870 120 244 PF01562 Peptidase M12B

IPR001590 301 504 PF01421 Peptidase M12B

IPR000884 599 649 PF00090 Thrombospondin

IPR010294 755 867 PF05986 ADAM-TS Spacer 1

IPR000884 938 995 PF00090 Thrombospondin

IPR000884 999 1056 PF00090 Thrombospondin

IPR000884 1064 1110 PF00090 Thrombospondin

IPR000884 1137 1189 PF00090 Thrombospondin

HMMSmart IPR000884 598 650 SM00209 Thrombospondin

IPR000884 883 937 SM00209 Thrombospondin

IPR000884 939 996 SM00209 Thrombospondin

IPR000884 998 1057 SM00209 Thrombospondin

IPR000884 1063 1124 SM00209 Thrombospondin

IPR000884 1138 1190 SM00209 Thrombospondin

ProfileScan IPR001590 299 504 PS50215 Peptidase M12B

IPR000884 595 651 PS50092 Thrombospondin

IPR000884 1130 1191 PS50092 Thrombospondin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002870	120	244	PF01562	Peptidase M12B
IPR001590	301	504	PF01421	Peptidase M12B
IPR000884	599	649	PF00090	Thrombospondin
IPR010294	755	867	PF05986	ADAM-TS Spacer 1
IPR000884	938	995	PF00090	Thrombospondin
IPR000884	999	1056	PF00090	Thrombospondin
IPR000884	1064	1110	PF00090	Thrombospondin
IPR000884	1137	1189	PF00090	Thrombospondin
HMMSmart	IPR000884	598	650	SM00209	Thrombospondin
IPR000884	883	937	SM00209	Thrombospondin
IPR000884	939	996	SM00209	Thrombospondin
IPR000884	998	1057	SM00209	Thrombospondin
IPR000884	1063	1124	SM00209	Thrombospondin
IPR000884	1138	1190	SM00209	Thrombospondin
ProfileScan	IPR001590	299	504	PS50215	Peptidase M12B
IPR000884	595	651	PS50092	Thrombospondin
IPR000884	1130	1191	PS50092	Thrombospondin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1038 bp
Genome contig ID	gi65535943r_66679512
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TATTTGCTGAAGTTTTATAATAAATTTTATATTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGGTGTGCTTTGGAACCACTTCATGGTTTTTTCATGAGGTCTACTGCTG

Gene/Protein Characteristic Table for mKIAA2029

Features of the cloned DNA sequence

Features of the protein sequence