HUGE

Gene/Protein Characteristic Table for KIAA1312

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04046
Accession No. :	AB037733
Description :	ADAMTS-9 precursor.
HUGO Gene Name :	ADAM metallopeptidase with thrombospondin type 1 motif, 9 (ADAMTS9)
Clone Name :	fh11767 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5139 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 722 bp

Genome contig ID gi89161205r_64410865
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ACCCTTTTTAATGGTAATAAACCAGTAGTAATCAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCATGATTATATTATTTTCAAACATCGTAATATGTTCATATCTGTATGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 64510865 64647326 30 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1471 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2N4	100.0	A disintegrin a...	Homo sapiens
AAO15765	99.9	a disintegrin-l...	Homo sapiens
XP_528704	99.6	ADAM metallopep...	Pan troglodytes
XP_001091856	99.3	similar to ADAM...	Macaca mulatta
XP_001488010	93.9	ADAM metallopep...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037767	2.9e-107	39.8	KIAA1346
AB014588	2e-92	46.0	KIAA0688
AB095949	1.6e-85	33.5	KIAA2029
AB002364	1.6e-72	32.5	KIAA0366
AB018305	5.8e-13	26.3	KIAA0762

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR013273 439 457 PR01857 Peptidase M12B

IPR013273 555 574 PR01857 Peptidase M12B

IPR013273 575 594 PR01857 Peptidase M12B

HMMPfam IPR002870 5 49 PF01562 Peptidase M12B

IPR001590 135 341 PF01421 Peptidase M12B

IPR000884 434 484 PF00090 Thrombospondin

IPR010294 595 713 PF05986 ADAM-TS Spacer 1

IPR000884 841 895 PF00090 Thrombospondin

IPR000884 898 950 PF00090 Thrombospondin

IPR000884 953 976 PF00090 Thrombospondin

IPR000884 1026 1051 PF00090 Thrombospondin

IPR000884 1089 1137 PF00090 Thrombospondin

IPR000884 1174 1225 PF00090 Thrombospondin

IPR000884 1228 1281 PF00090 Thrombospondin

IPR000884 1287 1322 PF00090 Thrombospondin

IPR000884 1346 1367 PF00090 Thrombospondin

IPR000884 1404 1454 PF00090 Thrombospondin

HMMSmart IPR000884 433 485 SM00209 Thrombospondin

IPR000884 723 778 SM00209 Thrombospondin

IPR000884 780 828 SM00209 Thrombospondin

IPR000884 842 896 SM00209 Thrombospondin

IPR000884 897 946 SM00209 Thrombospondin

IPR000884 952 1008 SM00209 Thrombospondin

IPR000884 1028 1082 SM00209 Thrombospondin

IPR000884 1084 1138 SM00209 Thrombospondin

IPR000884 1174 1226 SM00209 Thrombospondin

IPR000884 1227 1282 SM00209 Thrombospondin

IPR000884 1286 1341 SM00209 Thrombospondin

IPR000884 1343 1397 SM00209 Thrombospondin

IPR000884 1400 1455 SM00209 Thrombospondin

ProfileScan IPR001590 135 341 PS50215 Peptidase M12B

IPR000884 430 485 PS50092 Thrombospondin

IPR000884 720 778 PS50092 Thrombospondin

IPR000884 839 896 PS50092 Thrombospondin

IPR000884 897 946 PS50092 Thrombospondin

IPR000884 949 1008 PS50092 Thrombospondin

IPR000884 1024 1082 PS50092 Thrombospondin

IPR000884 1083 1138 PS50092 Thrombospondin

IPR000884 1170 1221 PS50092 Thrombospondin

IPR000884 1224 1282 PS50092 Thrombospondin

IPR000884 1283 1336 PS50092 Thrombospondin

IPR000884 1339 1397 PS50092 Thrombospondin

IPR000884 1398 1455 PS50092 Thrombospondin

ScanRegExp IPR006025 273 282 PS00142 Peptidase M

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR013273	439	457	PR01857	Peptidase M12B
IPR013273	555	574	PR01857	Peptidase M12B
IPR013273	575	594	PR01857	Peptidase M12B
HMMPfam	IPR002870	5	49	PF01562	Peptidase M12B
IPR001590	135	341	PF01421	Peptidase M12B
IPR000884	434	484	PF00090	Thrombospondin
IPR010294	595	713	PF05986	ADAM-TS Spacer 1
IPR000884	841	895	PF00090	Thrombospondin
IPR000884	898	950	PF00090	Thrombospondin
IPR000884	953	976	PF00090	Thrombospondin
IPR000884	1026	1051	PF00090	Thrombospondin
IPR000884	1089	1137	PF00090	Thrombospondin
IPR000884	1174	1225	PF00090	Thrombospondin
IPR000884	1228	1281	PF00090	Thrombospondin
IPR000884	1287	1322	PF00090	Thrombospondin
IPR000884	1346	1367	PF00090	Thrombospondin
IPR000884	1404	1454	PF00090	Thrombospondin
HMMSmart	IPR000884	433	485	SM00209	Thrombospondin
IPR000884	723	778	SM00209	Thrombospondin
IPR000884	780	828	SM00209	Thrombospondin
IPR000884	842	896	SM00209	Thrombospondin
IPR000884	897	946	SM00209	Thrombospondin
IPR000884	952	1008	SM00209	Thrombospondin
IPR000884	1028	1082	SM00209	Thrombospondin
IPR000884	1084	1138	SM00209	Thrombospondin
IPR000884	1174	1226	SM00209	Thrombospondin
IPR000884	1227	1282	SM00209	Thrombospondin
IPR000884	1286	1341	SM00209	Thrombospondin
IPR000884	1343	1397	SM00209	Thrombospondin
IPR000884	1400	1455	SM00209	Thrombospondin
ProfileScan	IPR001590	135	341	PS50215	Peptidase M12B
IPR000884	430	485	PS50092	Thrombospondin
IPR000884	720	778	PS50092	Thrombospondin
IPR000884	839	896	PS50092	Thrombospondin
IPR000884	897	946	PS50092	Thrombospondin
IPR000884	949	1008	PS50092	Thrombospondin
IPR000884	1024	1082	PS50092	Thrombospondin
IPR000884	1083	1138	PS50092	Thrombospondin
IPR000884	1170	1221	PS50092	Thrombospondin
IPR000884	1224	1282	PS50092	Thrombospondin
IPR000884	1283	1336	PS50092	Thrombospondin
IPR000884	1339	1397	PS50092	Thrombospondin
IPR000884	1398	1455	PS50092	Thrombospondin
ScanRegExp	IPR006025	273	282	PS00142	Peptidase M

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTAACCATCGTCAGCTCAGCC

Primer_r
: CAGTTCACAGTGGCAAATCGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GTAACCATCGTCAGCTCAGCC
Primer_r	: CAGTTCACAGTGGCAAATCGG
PCR product length	: 113 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	722 bp
Genome contig ID	gi89161205r_64410865
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACCCTTTTTAATGGTAATAAACCAGTAGTAATCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCATGATTATATTATTTTCAAACATCGTAATATGTTCATATCTGTATGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	64510865	64647326	30	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1312

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information