Gene/Protein Characteristic Table for KIAA1807

Length: 3140 bp

Restriction map

Length of 3'UTR	1030 bp
Genome contig ID	gi89161207f_129889708
PolyA signal sequence (AAGAAA,-14)	+----*----+----*----+----*----+---- AAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAAAAG
Flanking genome sequence (124191 - 124240)	----+----*----+----*----+----*----+----*----+----* AAAAAAGAAAAAAAGAGAAAAAAGCGAAATAGGTTATATTTTAAAAACAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	129989708	130013897	7	99.4	Perfect prediction

Length: 702 aa

Entry Exp ID% Protein Source XP_001158185 0 100.0 PHD finger prot... Pan troglodytes EAX05170 0 100.0 PHD finger prot... Homo sapiens BAC86931 0 100.0 unnamed protein... Homo sapiens BAG65104 0 100.0 unnamed protein... Homo sapiens Q6IE81 0 100.0 Protein Jade-1;... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% HUGE_ID D87076 7.6e-63 49.4 KIAA0239 D86969 3.8e-60 45.1 KIAA0215 AB033112 2.1e-27 33.7 KIAA1286 AB020683 2.9e-14 38.3 KIAA0876 AB018326 3.1e-13 27.7 KIAA0783

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	65	113	PF00628	Zinc finger
	IPR001965	174	201	PF00628	Zinc finger
HMMSmart	IPR001965	65	111	SM00249	Zinc finger
	IPR001965	174	229	SM00249	Zinc finger
ProfileScan	IPR001965	63	113	PS50016	Zinc finger
ScanRegExp	IPR001965	66	110	PS01359	Zinc finger

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-