HUGE |
Gene/Protein Characteristic Table for KIAA1286 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB033112 |
Description : | Bromodomain and PHD finger-containing protein 3. |
HUGO Gene Name : | bromodomain and PHD finger containing, 3 (BRPF3) |
Clone Name : | hh11961 [Vector Info] |
Flexi ORF Clone : | pF1KA1286
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5876 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | ||
Warning for N-terminal truncation: | NO | NO |
Warning for coding interruption: | YES | NO |
Length of 3'UTR 2176 bp Genome contig ID gi89161210f_36172590 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TATTTTCTCTCTGAGAAATAAATGTTCTAATGGGCFlanking genome sequence
(135953 - 136002) ----+----*----+----*----+----*----+----*----+----*
AGTAGTTGCTGTGTTGTGTTTAATCAGTAGGGGCCTACCCCTGTCTTCCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 36272528 36308541 13 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1214 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001487 | 632 | 648 | PR00503 | Bromodomain |
IPR001487 | 648 | 666 | PR00503 | Bromodomain | |
IPR001487 | 666 | 685 | PR00503 | Bromodomain | |
HMMPfam | IPR001965 | 223 | 271 | PF00628 | Zinc finger |
IPR001487 | 603 | 690 | PF00439 | Bromodomain | |
IPR000313 | 1082 | 1182 | PF00855 | PWWP | |
HMMSmart | IPR001965 | 223 | 269 | SM00249 | Zinc finger |
IPR001965 | 333 | 396 | SM00249 | Zinc finger | |
IPR001487 | 596 | 704 | SM00297 | Bromodomain | |
IPR000313 | 1083 | 1166 | SM00293 | PWWP | |
ProfileScan | IPR001965 | 221 | 271 | PS50016 | Zinc finger |
IPR001487 | 615 | 685 | PS50014 | Bromodomain | |
IPR000313 | 1085 | 1168 | PS50812 | PWWP | |
ScanRegExp | IPR001965 | 224 | 268 | PS01359 | Zinc finger |
IPR001487 | 620 | 677 | PS00633 | Bromodomain |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: AATGATAGCAAACCTCCAAGC | |
: GATAGTCTGTTGATGCCATTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 6 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |