| HUGE |
Gene/Protein Characteristic Table for KIAA1777 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK07288 |
|---|---|
| Accession No. : | AB055056 |
| Description : | Netrin receptor UNC5D precursor. |
| HUGO Gene Name : | unc-5 homolog D (C. elegans) (UNC5D) |
| Clone Name : | fh19201x1 |
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 7002 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 4100 bp Genome contig ID gi51511724f_35421483 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TCCAATGTCACAAAAGTGAAAATGTTACTAATCTTFlanking genome sequence
(350241 - 350290) ----+----*----+----*----+----*----+----*----+----*
AGATGTGTTGCATATTTTGTGTTTTTACGTTCCAAACTCTTTCAAAAGCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 f 35521452 35771722 17 99.4 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 954 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : GACTGGATTAGAGGTGATGGC | |
| : GTGGAAACTACGGAAACGGTG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 8 |
| : CCR | |
| : GACTGGATTAGAGGTGATGGC | |
| : GTGGAAACTACGGAAACGGTG | |
| : 163 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |