HUGE |
Gene/Protein Characteristic Table for KIAA1777 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK07288 |
---|---|
Accession No. : | AB055056 |
Description : | Netrin receptor UNC5D precursor. |
HUGO Gene Name : | unc-5 homolog D (C. elegans) (UNC5D) |
Clone Name : | fh19201x1 |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7002 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 4100 bp Genome contig ID gi51511724f_35421483 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TCCAATGTCACAAAAGTGAAAATGTTACTAATCTTFlanking genome sequence
(350241 - 350290) ----+----*----+----*----+----*----+----*----+----*
AGATGTGTTGCATATTTTGTGTTTTTACGTTCCAAACTCTTTCAAAAGCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 8 f 35521452 35771722 17 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 954 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: GACTGGATTAGAGGTGATGGC | |
: GTGGAAACTACGGAAACGGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 8 |
: CCR | |
: GACTGGATTAGAGGTGATGGC | |
: GTGGAAACTACGGAAACGGTG | |
: 163 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |