HUGE

Gene/Protein Characteristic Table for KIAA1445

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00840
Accession No. :	AB040878
Description :	Semaphorin-5B precursor.
HUGO Gene Name :	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B (SEMA5B)
Clone Name :	fg03469b [Vector Info]
Flexi ORF Clone :	pF1KSDA1445
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4559 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 950 bp

Genome contig ID gi89161205r_124010730
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
GTGGCATTATTAATTAAAGATGATATCCAGTCTCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATGTCTCTGTGCATCTGTGCGTGGGCTCCTCTTGCATAGTCTAGGCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 124110730 124229115 23 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1202 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAH12129	98.9	unnamed protein...	Homo sapiens
BAG10070	100.0	semaphorin-5B p...	synthetic construct
AAH77726	99.9	Sema domain, se...	Homo sapiens
Q9P283	99.7	Semaphorin-5B.	Homo sapiens
EAW79458	99.7	sema domain, se...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040912	7.6e-39	35.8	KIAA1479
AB037789	1.2e-36	34.2	KIAA1368
AB058772	9.9e-36	36.2	KIAA1869
AB051526	1.3e-25	31.7	KIAA1739
AB051532	1.5e-20	33.1	KIAA1745

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR008085 905 918 PR01705 Thrombospondin

IPR008085 923 934 PR01705 Thrombospondin

IPR008085 942 953 PR01705 Thrombospondin

HMMPfam IPR001627 177 588 PF01403 Semaphorin/CD100 antigen

IPR002165 606 653 PF01437 Plexin

IPR000884 719 770 PF00090 Thrombospondin

IPR000884 777 821 PF00090 Thrombospondin

IPR000884 908 958 PF00090 Thrombospondin

IPR000884 965 1015 PF00090 Thrombospondin

IPR000884 1020 1060 PF00090 Thrombospondin

HMMSmart IPR001627 177 588 SM00630 Semaphorin/CD100 antigen

IPR003659 606 653 SM00423 Plexin/semaphorin/integrin

IPR000884 718 771 SM00209 Thrombospondin

IPR000884 776 822 SM00209 Thrombospondin

IPR000884 907 959 SM00209 Thrombospondin

IPR000884 964 1016 SM00209 Thrombospondin

IPR000884 1019 1066 SM00209 Thrombospondin

ProfileScan IPR001627 154 604 PS51004 Semaphorin/CD100 antigen

IPR000884 715 771 PS50092 Thrombospondin

IPR000884 773 822 PS50092 Thrombospondin

IPR000884 904 959 PS50092 Thrombospondin

IPR000884 961 1016 PS50092 Thrombospondin

IPR000884 1017 1061 PS50092 Thrombospondin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008085	905	918	PR01705	Thrombospondin
IPR008085	923	934	PR01705	Thrombospondin
IPR008085	942	953	PR01705	Thrombospondin
HMMPfam	IPR001627	177	588	PF01403	Semaphorin/CD100 antigen
IPR002165	606	653	PF01437	Plexin
IPR000884	719	770	PF00090	Thrombospondin
IPR000884	777	821	PF00090	Thrombospondin
IPR000884	908	958	PF00090	Thrombospondin
IPR000884	965	1015	PF00090	Thrombospondin
IPR000884	1020	1060	PF00090	Thrombospondin
HMMSmart	IPR001627	177	588	SM00630	Semaphorin/CD100 antigen
IPR003659	606	653	SM00423	Plexin/semaphorin/integrin
IPR000884	718	771	SM00209	Thrombospondin
IPR000884	776	822	SM00209	Thrombospondin
IPR000884	907	959	SM00209	Thrombospondin
IPR000884	964	1016	SM00209	Thrombospondin
IPR000884	1019	1066	SM00209	Thrombospondin
ProfileScan	IPR001627	154	604	PS51004	Semaphorin/CD100 antigen
IPR000884	715	771	PS50092	Thrombospondin
IPR000884	773	822	PS50092	Thrombospondin
IPR000884	904	959	PS50092	Thrombospondin
IPR000884	961	1016	PS50092	Thrombospondin
IPR000884	1017	1061	PS50092	Thrombospondin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TACTGGGAACTGGAGGCTGAC

Primer_r
: AAGCAGGTCTCAGCCAACAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGAGGATCAATGCCATAGGAG
Primer_r	: AAGCAGGTCTCAGCCAACAAC
PCR product length	: 100 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	950 bp
Genome contig ID	gi89161205r_124010730
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- GTGGCATTATTAATTAAAGATGATATCCAGTCTCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGTCTCTGTGCATCTGTGCGTGGGCTCCTCTTGCATAGTCTAGGCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	124110730	124229115	23	99.6	Perfect prediction

Primer_f	: TACTGGGAACTGGAGGCTGAC
Primer_r	: AAGCAGGTCTCAGCCAACAAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1445

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information