HUGE

Gene/Protein Characteristic Table for KIAA2036

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK07687
Accession No. :	AB111888
Description :	SCO-spondin homolog (Fragment).
HUGO Gene Name :
Clone Name :	pf06513 [Vector Info]
Source :	Human brain (hippocampus)

Features of the cloned DNA sequence	Description

Length: 7480 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2399 bp

Genome contig ID gi89161213f_149014241
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATGGGATACATTATAATTTCATTCTCAGTCTGGTT
Flanking genome sequence
(112864 - 112913)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAGGCTGTCTTTGAATGCATCTCTTGCCAGAAAATG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 149114241 149127103 22 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1322 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
A2VEC9	2.4e-188	89.2	SCO-spondin; Fl...	Homo sapiens
EAW80030	3.6e-186	84.0	hCG16178, isofo...	Homo sapiens
EAW80031	3.6e-186	84.0	hCG16178, isofo...	Homo sapiens
XP_001096454	1.8e-180	83.9	similar to subc...	Macaca mulatta
XP_001915998	2.6e-159	68.3	similar to SCO-...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011540	1.5e-10	37.1	KIAA0816
AB075845	2.4e-08	33.7	KIAA1965
AB011122	3.7e-05	29.4	KIAA0550
D63483	0.00023	26.5	KIAA0149
AB040878	0.00033	25.9	KIAA1445

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002172 273 294 PR00261 Low density lipoprotein-receptor

IPR002172 312 333 PR00261 Low density lipoprotein-receptor

IPR002172 348 369 PR00261 Low density lipoprotein-receptor

IPR002172 461 482 PR00261 Low density lipoprotein-receptor

IPR002172 500 521 PR00261 Low density lipoprotein-receptor

IPR002172 597 618 PR00261 Low density lipoprotein-receptor

HMMPfam IPR001846 13 49 PF00094 von Willebrand factor

IPR014853 84 158 PF08742 Domain of unknown function DUF1787

IPR002919 161 217 PF01826 Protease inhibitor I8

IPR002172 260 297 PF00057 Low density lipoprotein-receptor

IPR002172 300 338 PF00057 Low density lipoprotein-receptor

IPR002172 345 372 PF00057 Low density lipoprotein-receptor

IPR002172 376 414 PF00057 Low density lipoprotein-receptor

IPR002172 449 485 PF00057 Low density lipoprotein-receptor

IPR002172 487 526 PF00057 Low density lipoprotein-receptor

IPR002172 584 621 PF00057 Low density lipoprotein-receptor

IPR000884 706 755 PF00090 Thrombospondin

IPR000884 762 815 PF00090 Thrombospondin

IPR000884 921 972 PF00090 Thrombospondin

IPR001007 975 1032 PF00093 von Willebrand factor

IPR000421 1123 1176 PF00754 Coagulation factor 5/8 type

HMMSmart IPR002172 261 299 SM00192 Low density lipoprotein-receptor

IPR002172 301 335 SM00192 Low density lipoprotein-receptor

IPR002172 337 374 SM00192 Low density lipoprotein-receptor

IPR002172 377 416 SM00192 Low density lipoprotein-receptor

IPR002172 450 487 SM00192 Low density lipoprotein-receptor

IPR002172 488 528 SM00192 Low density lipoprotein-receptor

IPR002172 585 623 SM00192 Low density lipoprotein-receptor

IPR000884 705 756 SM00209 Thrombospondin

IPR000884 761 816 SM00209 Thrombospondin

IPR001007 878 919 SM00214 von Willebrand factor

IPR000884 920 973 SM00209 Thrombospondin

IPR001007 975 1032 SM00214 von Willebrand factor

ProfileScan IPR001846 1 105 PS51233 von Willebrand factor

IPR002172 261 298 PS50068 Low density lipoprotein-receptor

IPR002172 301 339 PS50068 Low density lipoprotein-receptor

IPR002172 337 373 PS50068 Low density lipoprotein-receptor

IPR002172 377 415 PS50068 Low density lipoprotein-receptor

IPR002172 450 486 PS50068 Low density lipoprotein-receptor

IPR002172 488 527 PS50068 Low density lipoprotein-receptor

IPR002172 585 622 PS50068 Low density lipoprotein-receptor

IPR000884 702 756 PS50092 Thrombospondin

IPR000884 758 816 PS50092 Thrombospondin

IPR000884 917 973 PS50092 Thrombospondin

IPR001007 973 1033 PS50184 von Willebrand factor

IPR000421 1073 1176 PS50022 Coagulation factor 5/8 type

ScanRegExp IPR002172 275 297 PS01209 Low density lipoprotein-receptor

IPR002172 314 338 PS01209 Low density lipoprotein-receptor

IPR002172 350 372 PS01209 Low density lipoprotein-receptor

IPR002172 390 414 PS01209 Low density lipoprotein-receptor

IPR002172 502 526 PS01209 Low density lipoprotein-receptor

IPR002172 599 621 PS01209 Low density lipoprotein-receptor

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002172	273	294	PR00261	Low density lipoprotein-receptor
IPR002172	312	333	PR00261	Low density lipoprotein-receptor
IPR002172	348	369	PR00261	Low density lipoprotein-receptor
IPR002172	461	482	PR00261	Low density lipoprotein-receptor
IPR002172	500	521	PR00261	Low density lipoprotein-receptor
IPR002172	597	618	PR00261	Low density lipoprotein-receptor
HMMPfam	IPR001846	13	49	PF00094	von Willebrand factor
IPR014853	84	158	PF08742	Domain of unknown function DUF1787
IPR002919	161	217	PF01826	Protease inhibitor I8
IPR002172	260	297	PF00057	Low density lipoprotein-receptor
IPR002172	300	338	PF00057	Low density lipoprotein-receptor
IPR002172	345	372	PF00057	Low density lipoprotein-receptor
IPR002172	376	414	PF00057	Low density lipoprotein-receptor
IPR002172	449	485	PF00057	Low density lipoprotein-receptor
IPR002172	487	526	PF00057	Low density lipoprotein-receptor
IPR002172	584	621	PF00057	Low density lipoprotein-receptor
IPR000884	706	755	PF00090	Thrombospondin
IPR000884	762	815	PF00090	Thrombospondin
IPR000884	921	972	PF00090	Thrombospondin
IPR001007	975	1032	PF00093	von Willebrand factor
IPR000421	1123	1176	PF00754	Coagulation factor 5/8 type
HMMSmart	IPR002172	261	299	SM00192	Low density lipoprotein-receptor
IPR002172	301	335	SM00192	Low density lipoprotein-receptor
IPR002172	337	374	SM00192	Low density lipoprotein-receptor
IPR002172	377	416	SM00192	Low density lipoprotein-receptor
IPR002172	450	487	SM00192	Low density lipoprotein-receptor
IPR002172	488	528	SM00192	Low density lipoprotein-receptor
IPR002172	585	623	SM00192	Low density lipoprotein-receptor
IPR000884	705	756	SM00209	Thrombospondin
IPR000884	761	816	SM00209	Thrombospondin
IPR001007	878	919	SM00214	von Willebrand factor
IPR000884	920	973	SM00209	Thrombospondin
IPR001007	975	1032	SM00214	von Willebrand factor
ProfileScan	IPR001846	1	105	PS51233	von Willebrand factor
IPR002172	261	298	PS50068	Low density lipoprotein-receptor
IPR002172	301	339	PS50068	Low density lipoprotein-receptor
IPR002172	337	373	PS50068	Low density lipoprotein-receptor
IPR002172	377	415	PS50068	Low density lipoprotein-receptor
IPR002172	450	486	PS50068	Low density lipoprotein-receptor
IPR002172	488	527	PS50068	Low density lipoprotein-receptor
IPR002172	585	622	PS50068	Low density lipoprotein-receptor
IPR000884	702	756	PS50092	Thrombospondin
IPR000884	758	816	PS50092	Thrombospondin
IPR000884	917	973	PS50092	Thrombospondin
IPR001007	973	1033	PS50184	von Willebrand factor
IPR000421	1073	1176	PS50022	Coagulation factor 5/8 type
ScanRegExp	IPR002172	275	297	PS01209	Low density lipoprotein-receptor
IPR002172	314	338	PS01209	Low density lipoprotein-receptor
IPR002172	350	372	PS01209	Low density lipoprotein-receptor
IPR002172	390	414	PS01209	Low density lipoprotein-receptor
IPR002172	502	526	PS01209	Low density lipoprotein-receptor
IPR002172	599	621	PS01209	Low density lipoprotein-receptor

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2399 bp
Genome contig ID	gi89161213f_149014241
PolyA signal sequence (None)	+--------+--------+----*----+---- ATGGGATACATTATAATTTCATTCTCAGTCTGGTT
Flanking genome sequence (112864 - 112913)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGGCTGTCTTTGAATGCATCTCTTGCCAGAAAATG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	149114241	149127103	22	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA2036

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information