ROUGE

Gene/Protein Characteristic Table for mKIAA1777

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220417
Description :	netrin receptor Unc5h4. unc5 homolog (C. elegans) 4.
Clone Name :	mbg06236 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6383 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4873 bp

Genome contig ID gi65515060r_27326427
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATATGCCCCTTTGTTTCAAATTTATCTGACTCATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAGAAGAAGAAAGAAAAGAAAAGAAATGATTCAGACCGAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1777 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1777	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..1510
Length: 502 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI45696	100.0	Unc5d protein [...	Mus musculus
Q8K1S2	100.0	Netrin receptor...	Mus musculus
AAI44785	99.8	Unc5d protein [...	Mus musculus
XP_001494141	97.8	similar to Netr...	Equus caballus
XP_001088208	97.4	netrin receptor...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122575	6.3e-33	40.4	mKIAA1976

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000906 89 191 PF00791 ZU5

IPR000488 408 485 PF00531 Death

HMMSmart IPR000906 89 191 SM00218 ZU5

IPR000488 396 487 SM00005 Death

ScanRegExp IPR000215 32 42 PS00284 Proteinase inhibitor I4

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000906	89	191	PF00791	ZU5
IPR000488	408	485	PF00531	Death
HMMSmart	IPR000906	89	191	SM00218	ZU5
IPR000488	396	487	SM00005	Death
ScanRegExp	IPR000215	32	42	PS00284	Proteinase inhibitor I4

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4873 bp
Genome contig ID	gi65515060r_27326427
PolyA signal sequence (None)	+--------+--------+----*----+---- ATATGCCCCTTTGTTTCAAATTTATCTGACTCATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAGAAGAAGAAAGAAAAGAAAAGAAATGATTCAGACCGAA

Gene/Protein Characteristic Table for mKIAA1777

Features of the cloned DNA sequence

Features of the protein sequence