HUGE

Gene/Protein Characteristic Table for KIAA1631

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06023
Accession No. :	AB046851
Description :	Putative helicase MOV-10.
HUGO Gene Name :
Clone Name :	fh15959s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fh15959, former representative clones for KIAA1631 with fh15959s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4100 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 227 bp

Genome contig ID gi89161185f_112918972
PolyA signal sequence
(AAGAAA,-33)
+----*----+----*----+----*----+----
GGAAGAAAACTCTGAAAACAAAATCTTGTTCTATG
Flanking genome sequence
(125909 - 125958)
----+----*----+----*----+----*----+----*----+----*
CAAAAGCCTTGATAATGTCTCCTCTGCCTGGCCCCAGCTTCCTGAGCCCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 113018843 113044879 22 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1032 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCE1	100.0	Putative helica...	Homo sapiens
XP_513630	100.0	Mov10, Moloney ...	Pan troglodytes
ABM87844	99.9	Mov10, Moloney ...	synthetic construct
CAL37885	99.7	hypothetical pr...	synthetic construct
XP_001108355	99.0	similar to Mov1...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D29677	1.6e-08	29.8	KIAA0054
AB051556	2e-07	25.8	KIAA1769
D86988	0.00013	30.5	KIAA0221

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR000886 1029 1032 PS00014 Endoplasmic reticulum targeting sequence

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR000886	1029	1032	PS00014	Endoplasmic reticulum targeting sequence

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGTCTTCCCTCAGTCCTTCCA

Primer_r
: GGATCGGAGGAATGTTTAATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	227 bp
Genome contig ID	gi89161185f_112918972
PolyA signal sequence (AAGAAA,-33)	+--------+--------+----*----+---- GGAAGAAAACTCTGAAAACAAAATCTTGTTCTATG
Flanking genome sequence (125909 - 125958)	----+--------+--------+--------+--------+----* CAAAAGCCTTGATAATGTCTCCTCTGCCTGGCCCCAGCTTCCTGAGCCCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	113018843	113044879	22	100.0	Perfect prediction

Primer_f	: TGTCTTCCCTCAGTCCTTCCA
Primer_r	: GGATCGGAGGAATGTTTAATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1631

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information