HUGE

Gene/Protein Characteristic Table for KIAA1092

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00737
Accession No. :	AB029015
Description :	Inactive phospholipase C-like protein 2.
HUGO Gene Name :	phospholipase C-like 2 (PLCL2)
Clone Name :	hk04417 [Vector Info]
Flexi ORF Clone :	pF1KSDA1092
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4147 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 682 bp

Genome contig ID gi89161205f_16801567
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
GAAGTAGTGTTCACATTAAAAAGATGTTTTATGAT
Flanking genome sequence
(305525 - 305574)
----+----*----+----*----+----*----+----*----+----*
ATTTCTCCAATAGCAGTACATGTGTTTAATGAAGCCTTAACTTTTAAGAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 16901456 17107090 6 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1154 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_526146	100.0	phospholipase C...	Pan troglodytes
Q9UPR0	100.0	Inactive phosph...	Homo sapiens
AAH27746	96.7	Plcl2 protein [...	Mus musculus
Q8K394	96.6	Inactive phosph...	Mus musculus
BAE32490	96.5	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB075844	1.3e-56	37.2	KIAA1964
AB007919	3e-48	37.0	KIAA0450
AB028992	4.6e-29	37.3	KIAA1069
AB040949	6.8e-19	28.0	KIAA1516
AB011153	3.7e-18	31.6	KIAA0581

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR013841 464 749 PD001202 Phosphatidylinositol-specific phospholipase C

FPrintScan IPR001192 458 476 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 484 504 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 581 598 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 699 720 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 720 738 PR00390 Phosphoinositide-specific phospholipase C

IPR000008 802 814 PR00360 C2 calcium-dependent membrane targeting

IPR000008 832 845 PR00360 C2 calcium-dependent membrane targeting

IPR001192 874 884 PR00390 Phosphoinositide-specific phospholipase C

HMMPfam IPR001849 169 278 PF00169 Pleckstrin-like

IPR015359 370 452 PF09279 EF-hand-like

IPR000909 454 598 PF00388 Phosphatidylinositol-specific phospholipase C

IPR001711 644 761 PF00387 Phosphatidylinositol-specific phospholipase C

IPR000008 783 873 PF00168 C2 calcium-dependent membrane targeting

HMMSmart IPR001849 169 280 SM00233 Pleckstrin-like

IPR000909 453 597 SM00148 Phosphatidylinositol-specific phospholipase C

IPR001711 645 761 SM00149 Phosphatidylinositol-specific phospholipase C

IPR000008 782 888 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR001849 168 278 PS50003 Pleckstrin-like

IPR000909 453 597 PS50007 Phosphatidylinositol-specific phospholipase C

IPR001711 645 761 PS50008 Phosphatidylinositol-specific phospholipase C

IPR000008 768 873 PS50004 C2 calcium-dependent membrane targeting

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013841	464	749	PD001202	Phosphatidylinositol-specific phospholipase C
FPrintScan	IPR001192	458	476	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	484	504	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	581	598	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	699	720	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	720	738	PR00390	Phosphoinositide-specific phospholipase C
IPR000008	802	814	PR00360	C2 calcium-dependent membrane targeting
IPR000008	832	845	PR00360	C2 calcium-dependent membrane targeting
IPR001192	874	884	PR00390	Phosphoinositide-specific phospholipase C
HMMPfam	IPR001849	169	278	PF00169	Pleckstrin-like
IPR015359	370	452	PF09279	EF-hand-like
IPR000909	454	598	PF00388	Phosphatidylinositol-specific phospholipase C
IPR001711	644	761	PF00387	Phosphatidylinositol-specific phospholipase C
IPR000008	783	873	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR001849	169	280	SM00233	Pleckstrin-like
IPR000909	453	597	SM00148	Phosphatidylinositol-specific phospholipase C
IPR001711	645	761	SM00149	Phosphatidylinositol-specific phospholipase C
IPR000008	782	888	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR001849	168	278	PS50003	Pleckstrin-like
IPR000909	453	597	PS50007	Phosphatidylinositol-specific phospholipase C
IPR001711	645	761	PS50008	Phosphatidylinositol-specific phospholipase C
IPR000008	768	873	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCCAATAATGTGCCTGTGAAG

Primer_r
: TTTCATTGGCGTACTTGCTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGAGAATGTAAGTGGACGGG
Primer_r	: ATGTATCTTCAGCCAGGGAGC
PCR product length	: 101 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	682 bp
Genome contig ID	gi89161205f_16801567
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- GAAGTAGTGTTCACATTAAAAAGATGTTTTATGAT
Flanking genome sequence (305525 - 305574)	----+--------+--------+--------+--------+----* ATTTCTCCAATAGCAGTACATGTGTTTAATGAAGCCTTAACTTTTAAGAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	16901456	17107090	6	99.6	Perfect prediction

Primer_f	: CCCAATAATGTGCCTGTGAAG
Primer_r	: TTTCATTGGCGTACTTGCTGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1092

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information