HUGE |
Gene/Protein Characteristic Table for KIAA1964 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK06387 |
---|---|
Accession No. : | AB075844 |
Description : | phospholipase C delta 3. |
HUGO Gene Name : | |
Clone Name : | ph00746 [Vector Info] |
Flexi ORF Clone : | pF1KA1964
![]() |
Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5926 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3651 bp Genome contig ID gi51511734r_40441861 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TTCTTTATTAGAAACAAGTGAGATGTATTGAGCAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AACAACAATGCATTTGGTATTTCCTCCCCGACCCTGGAAATGGATGCCCC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 40541861 40565208 15 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 757 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR013841 | 316 | 600 | PD001202 | Phosphatidylinositol-specific phospholipase C |
FPrintScan | IPR001192 | 310 | 328 | PR00390 | Phosphoinositide-specific phospholipase C |
IPR001192 | 336 | 356 | PR00390 | Phosphoinositide-specific phospholipase C | |
IPR001192 | 434 | 451 | PR00390 | Phosphoinositide-specific phospholipase C | |
IPR001192 | 550 | 571 | PR00390 | Phosphoinositide-specific phospholipase C | |
IPR001192 | 571 | 589 | PR00390 | Phosphoinositide-specific phospholipase C | |
IPR000008 | 648 | 660 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR000008 | 678 | 691 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR000008 | 700 | 708 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR001192 | 721 | 731 | PR00390 | Phosphoinositide-specific phospholipase C | |
HMMPfam | IPR015359 | 223 | 304 | PF09279 | EF-hand-like |
IPR000909 | 306 | 451 | PF00388 | Phosphatidylinositol-specific phospholipase C | |
IPR001711 | 495 | 612 | PF00387 | Phosphatidylinositol-specific phospholipase C | |
IPR000008 | 630 | 720 | PF00168 | C2 calcium-dependent membrane targeting | |
HMMSmart | IPR001849 | 33 | 142 | SM00233 | Pleckstrin-like |
IPR000909 | 305 | 450 | SM00148 | Phosphatidylinositol-specific phospholipase C | |
IPR001711 | 496 | 612 | SM00149 | Phosphatidylinositol-specific phospholipase C | |
IPR000008 | 629 | 735 | SM00239 | C2 calcium-dependent membrane targeting | |
ProfileScan | IPR000909 | 305 | 450 | PS50007 | Phosphatidylinositol-specific phospholipase C |
IPR001711 | 496 | 612 | PS50008 | Phosphatidylinositol-specific phospholipase C | |
IPR000008 | 615 | 720 | PS50004 | C2 calcium-dependent membrane targeting | |
ScanRegExp | IPR002048 | 199 | 211 | PS00018 | Calcium-binding EF-hand |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CGGATGAACTCAGCCAACTAC | |
: AGGCAGGTTTTAGGACGTAGC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |