HUGE

Gene/Protein Characteristic Table for KIAA0581

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01979
Accession No. :	AB011153
Description :	1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase beta 1.
HUGO Gene Name :	phospholipase C, beta 1 (phosphoinositide-specific) (PLCB1)
Clone Name :	pf10976 [Vector Info]
Flexi ORF Clone :	pF1KA0581
Source :	Human brain (hippocampus)
Note :	We replaced hj00610 and hj00610s1, former representative clones for KIAA0581 with pf10976. (2002/5/10,2002/5/10)

Features of the cloned DNA sequence	Description

Length: 7092 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3054 bp

Genome contig ID gi51511747f_7960912
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
CCAAAGGAAAGAATAAAAATTTCTTAACACAACCC
Flanking genome sequence
(852640 - 852689)
----+----*----+----*----+----*----+----*----+----*
AGCGGTTATTTCTTGGGGTCAGAGTCAACCTTCTTTTGACAGGGAAAGTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 8060912 8813550 32 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1218 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NQ66	100.0	1-phosphatidyli...	Homo sapiens
XP_001116017	99.2	similar to phos...	Macaca mulatta
XP_001170216	99.7	phosphoinositid...	Pan troglodytes
P10894	97.5	1-phosphatidyli...	Bos taurus
1611219A	97.4	phospholipase C...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040949	3.6e-14	27.7	KIAA1516
AB007919	6.4e-14	30.5	KIAA0450
AB029015	2e-12	31.0	KIAA1092
AB028992	5.4e-11	30.5	KIAA1069
AB075844	7e-11	30.9	KIAA1964

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR013841 329 654 PD001202 Phosphatidylinositol-specific phospholipase C

FPrintScan IPR001192 323 341 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 349 369 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 453 470 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 596 617 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 617 635 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 764 774 PR00390 Phosphoinositide-specific phospholipase C

HMMPfam IPR015359 226 317 PF09279 EF-hand-like

IPR000909 319 470 PF00388 Phosphatidylinositol-specific phospholipase C

IPR001711 541 658 PF00387 Phosphatidylinositol-specific phospholipase C

IPR000008 680 763 PF00168 C2 calcium-dependent membrane targeting

IPR014815 999 1191 PF08703 PLC-beta

HMMSmart IPR000909 318 469 SM00148 Phosphatidylinositol-specific phospholipase C

IPR001711 542 658 SM00149 Phosphatidylinositol-specific phospholipase C

IPR000008 679 778 SM00239 C2 calcium-dependent membrane targeting

ProfileScan IPR000909 318 469 PS50007 Phosphatidylinositol-specific phospholipase C

IPR001711 542 658 PS50008 Phosphatidylinositol-specific phospholipase C

IPR000008 665 763 PS50004 C2 calcium-dependent membrane targeting

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013841	329	654	PD001202	Phosphatidylinositol-specific phospholipase C
FPrintScan	IPR001192	323	341	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	349	369	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	453	470	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	596	617	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	617	635	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	764	774	PR00390	Phosphoinositide-specific phospholipase C
HMMPfam	IPR015359	226	317	PF09279	EF-hand-like
IPR000909	319	470	PF00388	Phosphatidylinositol-specific phospholipase C
IPR001711	541	658	PF00387	Phosphatidylinositol-specific phospholipase C
IPR000008	680	763	PF00168	C2 calcium-dependent membrane targeting
IPR014815	999	1191	PF08703	PLC-beta
HMMSmart	IPR000909	318	469	SM00148	Phosphatidylinositol-specific phospholipase C
IPR001711	542	658	SM00149	Phosphatidylinositol-specific phospholipase C
IPR000008	679	778	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000909	318	469	PS50007	Phosphatidylinositol-specific phospholipase C
IPR001711	542	658	PS50008	Phosphatidylinositol-specific phospholipase C
IPR000008	665	763	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGATGGATTGGACGTTGTGAC

Primer_r
: CAAGTGGAAGAAACATCATGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AGGGCCATTTGCTTGCATTAC
Primer_r	: TCACAACGTCCAATCCATCAC
PCR product length	: 85 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3054 bp
Genome contig ID	gi51511747f_7960912
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CCAAAGGAAAGAATAAAAATTTCTTAACACAACCC
Flanking genome sequence (852640 - 852689)	----+--------+--------+--------+--------+----* AGCGGTTATTTCTTGGGGTCAGAGTCAACCTTCTTTTGACAGGGAAAGTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	8060912	8813550	32	99.5	Perfect prediction

Primer_f	: TGATGGATTGGACGTTGTGAC
Primer_r	: CAAGTGGAAGAAACATCATGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0581

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information