HUGE

Gene/Protein Characteristic Table for KIAA1516

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01171
Accession No. :	AB040949
Description :	1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase epsilon 1.
HUGO Gene Name :	phospholipase C, epsilon 1 (PLCE1)
Clone Name :	fh10631s2 [Vector Info]
Flexi ORF Clone :	pF1KA1516
Source :	Human fetal brain
Note :	We replaced fh10631, former representative clones for KIAA1516 with fh10631s2. (2003/8/28)

Features of the cloned DNA sequence	Description

Length: 7989 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 446 bp

Genome contig ID gi89161187f_95643800
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
GCTGTATTCCAATAAAACTTTATTTATGGACACTG
Flanking genome sequence
(434338 - 434387)
----+----*----+----*----+----*----+----*----+----*
AAATTGGAATTTCATATATTTTTCACATGTCACAAATACTCTTGTTTTGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 95743736 96078136 33 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 2304 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI51855	100.0	Phospholipase C...	Homo sapiens
Q9P212	100.0	1-phosphatidyli...	Homo sapiens
CAH70739	100.0	phospholipase C...	Homo sapiens
AAG17145	99.9	phosphoinositid...	Homo sapiens
XP_001149565	99.3	pancreas-enrich...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028992	9.4e-25	33.6	KIAA1069
AB011153	5.3e-24	27.6	KIAA0581
AB007919	6.7e-23	32.6	KIAA0450
AB075844	1.1e-22	30.5	KIAA1964
AB029015	6.2e-22	27.9	KIAA1092

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR013841 1405 1569 PD001202 Phosphatidylinositol-specific phospholipase C

IPR013841 1752 1844 PD001202 Phosphatidylinositol-specific phospholipase C

FPrintScan IPR001192 1399 1417 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 1425 1445 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 1526 1543 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 1786 1807 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 1807 1825 PR00390 Phosphoinositide-specific phospholipase C

IPR001192 1956 1966 PR00390 Phosphoinositide-specific phospholipase C

HMMPfam IPR001895 553 727 PF00617 Guanine-nucleotide dissociation stimulator CDC25

IPR015359 1330 1381 PF09279 EF-hand-like

IPR000909 1395 1543 PF00388 Phosphatidylinositol-specific phospholipase C

IPR001711 1756 1848 PF00387 Phosphatidylinositol-specific phospholipase C

IPR000008 1873 1947 PF00168 C2 calcium-dependent membrane targeting

IPR000159 2137 2240 PF00788 Ras-association

HMMSmart IPR001895 530 833 SM00147 Guanine-nucleotide dissociation stimulator CDC25

IPR000909 1394 1542 SM00148 Phosphatidylinositol-specific phospholipase C

IPR001711 1731 1848 SM00149 Phosphatidylinositol-specific phospholipase C

IPR000008 1872 1970 SM00239 C2 calcium-dependent membrane targeting

IPR000159 2137 2240 SM00314 Ras-association

ProfileScan IPR001895 533 792 PS50009 Guanine-nucleotide dissociation stimulator CDC25

IPR000909 1394 1542 PS50007 Phosphatidylinositol-specific phospholipase C

IPR001711 1757 1847 PS50008 Phosphatidylinositol-specific phospholipase C

IPR000008 1862 1946 PS50004 C2 calcium-dependent membrane targeting

IPR000159 2137 2240 PS50200 Ras-association

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013841	1405	1569	PD001202	Phosphatidylinositol-specific phospholipase C
IPR013841	1752	1844	PD001202	Phosphatidylinositol-specific phospholipase C
FPrintScan	IPR001192	1399	1417	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	1425	1445	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	1526	1543	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	1786	1807	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	1807	1825	PR00390	Phosphoinositide-specific phospholipase C
IPR001192	1956	1966	PR00390	Phosphoinositide-specific phospholipase C
HMMPfam	IPR001895	553	727	PF00617	Guanine-nucleotide dissociation stimulator CDC25
IPR015359	1330	1381	PF09279	EF-hand-like
IPR000909	1395	1543	PF00388	Phosphatidylinositol-specific phospholipase C
IPR001711	1756	1848	PF00387	Phosphatidylinositol-specific phospholipase C
IPR000008	1873	1947	PF00168	C2 calcium-dependent membrane targeting
IPR000159	2137	2240	PF00788	Ras-association
HMMSmart	IPR001895	530	833	SM00147	Guanine-nucleotide dissociation stimulator CDC25
IPR000909	1394	1542	SM00148	Phosphatidylinositol-specific phospholipase C
IPR001711	1731	1848	SM00149	Phosphatidylinositol-specific phospholipase C
IPR000008	1872	1970	SM00239	C2 calcium-dependent membrane targeting
IPR000159	2137	2240	SM00314	Ras-association
ProfileScan	IPR001895	533	792	PS50009	Guanine-nucleotide dissociation stimulator CDC25
IPR000909	1394	1542	PS50007	Phosphatidylinositol-specific phospholipase C
IPR001711	1757	1847	PS50008	Phosphatidylinositol-specific phospholipase C
IPR000008	1862	1946	PS50004	C2 calcium-dependent membrane targeting
IPR000159	2137	2240	PS50200	Ras-association

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAAGAAGCTCACCAAGTCAAC

Primer_r
: CTGTCGGTAATCCATTGTGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	446 bp
Genome contig ID	gi89161187f_95643800
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GCTGTATTCCAATAAAACTTTATTTATGGACACTG
Flanking genome sequence (434338 - 434387)	----+--------+--------+--------+--------+----* AAATTGGAATTTCATATATTTTTCACATGTCACAAATACTCTTGTTTTGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	95743736	96078136	33	100.0	Perfect prediction

Primer_f	: CAAGAAGCTCACCAAGTCAAC
Primer_r	: CTGTCGGTAATCCATTGTGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1516

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information