HUGE |
Gene/Protein Characteristic Table for KIAA0816 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00133 |
---|---|
Accession No. : | AB011540 |
Description : | Low-density lipoprotein receptor-related protein 4 precursor. |
HUGO Gene Name : | |
Clone Name : | af09475 [Vector Info] |
Flexi ORF Clone : | pF1KA0816 |
Source : | Human brain (amygdala) |
Note : | We replaced ha06338, former representative clones for KIAA0816 with af09475. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7966 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2111 bp Genome contig ID gi51511727r_46734999 PolyA signal sequence
(TATAAA,-19) +----*----+----*----+----*----+----
CTTTATGATAATTTAATATAAATTTAGCTTTTCTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATCACCTTGCCTGGCTTGGAGTCATGACTAATCCTGCACCTGCTCTGTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 46834999 46896652 38 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1950 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 11 |
: nakayama | |
: GAAAGTCCAATCTCTCCAGTG | |
: AAGAGCAAGTAGAAAAGTGGC | |
: 224 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |