HUGE

Gene/Protein Characteristic Table for KIAA0816

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00133
Accession No. :	AB011540
Description :	Low-density lipoprotein receptor-related protein 4 precursor.
HUGO Gene Name :
Clone Name :	af09475 [Vector Info]
Flexi ORF Clone :	pF1KA0816
Source :	Human brain (amygdala)
Note :	We replaced ha06338, former representative clones for KIAA0816 with af09475. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 7966 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2111 bp

Genome contig ID gi51511727r_46734999
PolyA signal sequence
(TATAAA,-19)
+----*----+----*----+----*----+----
CTTTATGATAATTTAATATAAATTTAGCTTTTCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATCACCTTGCCTGGCTTGGAGTCATGACTAATCCTGCACCTGCTCTGTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 46834999 46896652 38 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1950 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAE19679	100.0	low-density lip...	Homo sapiens
XP_508403	99.3	low density lip...	Pan troglodytes
BAG10387	100.0	low-density lip...	synthetic construct
AAI36669	99.7	Low density lip...	Homo sapiens
BAD83615	99.7	low density lip...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB111888	8.3e-18	37.1	KIAA2036
AB011539	3.5e-14	27.3	KIAA0815
AB053450	1.9e-10	27.0	KIAA1776
AB058676	3.5e-09	26.3	KIAA1780
AB058677	1.5e-07	25.0	KIAA1781

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002172 129 150 PR00261 Low density lipoprotein-receptor

IPR002172 168 189 PR00261 Low density lipoprotein-receptor

IPR002172 206 227 PR00261 Low density lipoprotein-receptor

IPR002172 249 270 PR00261 Low density lipoprotein-receptor

IPR002172 289 310 PR00261 Low density lipoprotein-receptor

IPR002172 328 349 PR00261 Low density lipoprotein-receptor

HMMPfam IPR002172 73 114 PF00057 Low density lipoprotein-receptor

IPR002172 117 153 PF00057 Low density lipoprotein-receptor

IPR002172 156 191 PF00057 Low density lipoprotein-receptor

IPR002172 194 230 PF00057 Low density lipoprotein-receptor

IPR002172 237 273 PF00057 Low density lipoprotein-receptor

IPR002172 277 313 PF00057 Low density lipoprotein-receptor

IPR002172 316 352 PF00057 Low density lipoprotein-receptor

IPR002172 358 397 PF00057 Low density lipoprotein-receptor

IPR006209 406 441 PF00008 EGF-like

IPR013091 443 481 PF07645 EGF calcium-binding

IPR000033 528 569 PF00058 Low-density lipoprotein receptor

IPR000033 571 612 PF00058 Low-density lipoprotein receptor

IPR000033 614 656 PF00058 Low-density lipoprotein receptor

IPR000033 658 699 PF00058 Low-density lipoprotein receptor

IPR000033 701 741 PF00058 Low-density lipoprotein receptor

IPR006209 750 784 PF00008 EGF-like

IPR000033 833 874 PF00058 Low-density lipoprotein receptor

IPR000033 876 917 PF00058 Low-density lipoprotein receptor

IPR000033 919 961 PF00058 Low-density lipoprotein receptor

IPR000033 963 1004 PF00058 Low-density lipoprotein receptor

IPR000033 1005 1045 PF00058 Low-density lipoprotein receptor

IPR006209 1054 1091 PF00008 EGF-like

IPR000033 1141 1182 PF00058 Low-density lipoprotein receptor

IPR000033 1184 1225 PF00058 Low-density lipoprotein receptor

IPR000033 1227 1269 PF00058 Low-density lipoprotein receptor

IPR000033 1271 1311 PF00058 Low-density lipoprotein receptor

IPR000033 1312 1353 PF00058 Low-density lipoprotein receptor

IPR006209 1361 1396 PF00008 EGF-like

IPR000033 1445 1486 PF00058 Low-density lipoprotein receptor

IPR000033 1488 1526 PF00058 Low-density lipoprotein receptor

IPR000033 1528 1570 PF00058 Low-density lipoprotein receptor

IPR000033 1572 1617 PF00058 Low-density lipoprotein receptor

HMMSmart IPR002172 74 116 SM00192 Low density lipoprotein-receptor

IPR002172 118 155 SM00192 Low density lipoprotein-receptor

IPR002172 157 193 SM00192 Low density lipoprotein-receptor

IPR002172 195 232 SM00192 Low density lipoprotein-receptor

IPR002172 238 275 SM00192 Low density lipoprotein-receptor

IPR002172 278 315 SM00192 Low density lipoprotein-receptor

IPR002172 317 354 SM00192 Low density lipoprotein-receptor

IPR006210 317 353 SM00181 EGF

IPR002172 359 399 SM00192 Low density lipoprotein-receptor

IPR006210 405 442 SM00181 EGF

IPR001881 443 482 SM00179 EGF-like calcium-binding

IPR006210 446 482 SM00181 EGF

IPR000033 508 550 SM00135 Low-density lipoprotein receptor

IPR000033 551 593 SM00135 Low-density lipoprotein receptor

IPR000033 594 637 SM00135 Low-density lipoprotein receptor

IPR000033 638 680 SM00135 Low-density lipoprotein receptor

IPR000033 681 722 SM00135 Low-density lipoprotein receptor

IPR001881 746 785 SM00179 EGF-like calcium-binding

IPR006210 749 785 SM00181 EGF

IPR000033 813 855 SM00135 Low-density lipoprotein receptor

IPR000033 856 898 SM00135 Low-density lipoprotein receptor

IPR000033 899 942 SM00135 Low-density lipoprotein receptor

IPR000033 943 985 SM00135 Low-density lipoprotein receptor

IPR000033 986 1027 SM00135 Low-density lipoprotein receptor

IPR006210 1053 1092 SM00181 EGF

IPR000033 1121 1163 SM00135 Low-density lipoprotein receptor

IPR000033 1164 1206 SM00135 Low-density lipoprotein receptor

IPR000033 1207 1250 SM00135 Low-density lipoprotein receptor

IPR000033 1251 1293 SM00135 Low-density lipoprotein receptor

IPR000033 1294 1333 SM00135 Low-density lipoprotein receptor

IPR001881 1357 1397 SM00179 EGF-like calcium-binding

IPR006210 1360 1397 SM00181 EGF

IPR000033 1425 1467 SM00135 Low-density lipoprotein receptor

IPR000033 1468 1510 SM00135 Low-density lipoprotein receptor

IPR000033 1511 1551 SM00135 Low-density lipoprotein receptor

IPR000033 1552 1594 SM00135 Low-density lipoprotein receptor

IPR000033 1595 1635 SM00135 Low-density lipoprotein receptor

IPR006210 1661 1694 SM00181 EGF

ProfileScan IPR002172 74 115 PS50068 Low density lipoprotein-receptor

IPR002172 118 154 PS50068 Low density lipoprotein-receptor

IPR002172 157 192 PS50068 Low density lipoprotein-receptor

IPR002172 195 231 PS50068 Low density lipoprotein-receptor

IPR002172 238 274 PS50068 Low density lipoprotein-receptor

IPR002172 278 314 PS50068 Low density lipoprotein-receptor

IPR002172 317 353 PS50068 Low density lipoprotein-receptor

IPR002172 359 398 PS50068 Low density lipoprotein-receptor

IPR000033 528 570 PS51120 Low-density lipoprotein receptor

IPR000033 571 613 PS51120 Low-density lipoprotein receptor

IPR000033 614 657 PS51120 Low-density lipoprotein receptor

IPR000033 658 700 PS51120 Low-density lipoprotein receptor

IPR000033 701 741 PS51120 Low-density lipoprotein receptor

IPR000033 833 875 PS51120 Low-density lipoprotein receptor

IPR000033 876 918 PS51120 Low-density lipoprotein receptor

IPR000033 919 962 PS51120 Low-density lipoprotein receptor

IPR000033 963 1005 PS51120 Low-density lipoprotein receptor

IPR000033 1006 1046 PS51120 Low-density lipoprotein receptor

IPR000033 1141 1183 PS51120 Low-density lipoprotein receptor

IPR000033 1184 1226 PS51120 Low-density lipoprotein receptor

IPR000033 1227 1270 PS51120 Low-density lipoprotein receptor

IPR000033 1271 1312 PS51120 Low-density lipoprotein receptor

IPR000033 1313 1354 PS51120 Low-density lipoprotein receptor

IPR000033 1445 1487 PS51120 Low-density lipoprotein receptor

IPR000033 1488 1518 PS51120 Low-density lipoprotein receptor

IPR000033 1528 1571 PS51120 Low-density lipoprotein receptor

IPR000033 1572 1613 PS51120 Low-density lipoprotein receptor

IPR000033 1614 1655 PS51120 Low-density lipoprotein receptor

ScanRegExp IPR002172 92 114 PS01209 Low density lipoprotein-receptor

IPR002172 131 153 PS01209 Low density lipoprotein-receptor

IPR002172 170 191 PS01209 Low density lipoprotein-receptor

IPR002172 208 230 PS01209 Low density lipoprotein-receptor

IPR002172 251 273 PS01209 Low density lipoprotein-receptor

IPR002172 291 313 PS01209 Low density lipoprotein-receptor

IPR002172 330 352 PS01209 Low density lipoprotein-receptor

IPR002172 372 397 PS01209 Low density lipoprotein-receptor

IPR013032 426 441 PS01186 EGF-like region

IPR001881 443 466 PS01187 EGF-like calcium-binding

IPR000152 457 468 PS00010 Aspartic acid and asparagine hydroxylation site

IPR013032 466 481 PS01186 EGF-like region

IPR013032 770 784 PS01186 EGF-like region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002172	129	150	PR00261	Low density lipoprotein-receptor
IPR002172	168	189	PR00261	Low density lipoprotein-receptor
IPR002172	206	227	PR00261	Low density lipoprotein-receptor
IPR002172	249	270	PR00261	Low density lipoprotein-receptor
IPR002172	289	310	PR00261	Low density lipoprotein-receptor
IPR002172	328	349	PR00261	Low density lipoprotein-receptor
HMMPfam	IPR002172	73	114	PF00057	Low density lipoprotein-receptor
IPR002172	117	153	PF00057	Low density lipoprotein-receptor
IPR002172	156	191	PF00057	Low density lipoprotein-receptor
IPR002172	194	230	PF00057	Low density lipoprotein-receptor
IPR002172	237	273	PF00057	Low density lipoprotein-receptor
IPR002172	277	313	PF00057	Low density lipoprotein-receptor
IPR002172	316	352	PF00057	Low density lipoprotein-receptor
IPR002172	358	397	PF00057	Low density lipoprotein-receptor
IPR006209	406	441	PF00008	EGF-like
IPR013091	443	481	PF07645	EGF calcium-binding
IPR000033	528	569	PF00058	Low-density lipoprotein receptor
IPR000033	571	612	PF00058	Low-density lipoprotein receptor
IPR000033	614	656	PF00058	Low-density lipoprotein receptor
IPR000033	658	699	PF00058	Low-density lipoprotein receptor
IPR000033	701	741	PF00058	Low-density lipoprotein receptor
IPR006209	750	784	PF00008	EGF-like
IPR000033	833	874	PF00058	Low-density lipoprotein receptor
IPR000033	876	917	PF00058	Low-density lipoprotein receptor
IPR000033	919	961	PF00058	Low-density lipoprotein receptor
IPR000033	963	1004	PF00058	Low-density lipoprotein receptor
IPR000033	1005	1045	PF00058	Low-density lipoprotein receptor
IPR006209	1054	1091	PF00008	EGF-like
IPR000033	1141	1182	PF00058	Low-density lipoprotein receptor
IPR000033	1184	1225	PF00058	Low-density lipoprotein receptor
IPR000033	1227	1269	PF00058	Low-density lipoprotein receptor
IPR000033	1271	1311	PF00058	Low-density lipoprotein receptor
IPR000033	1312	1353	PF00058	Low-density lipoprotein receptor
IPR006209	1361	1396	PF00008	EGF-like
IPR000033	1445	1486	PF00058	Low-density lipoprotein receptor
IPR000033	1488	1526	PF00058	Low-density lipoprotein receptor
IPR000033	1528	1570	PF00058	Low-density lipoprotein receptor
IPR000033	1572	1617	PF00058	Low-density lipoprotein receptor
HMMSmart	IPR002172	74	116	SM00192	Low density lipoprotein-receptor
IPR002172	118	155	SM00192	Low density lipoprotein-receptor
IPR002172	157	193	SM00192	Low density lipoprotein-receptor
IPR002172	195	232	SM00192	Low density lipoprotein-receptor
IPR002172	238	275	SM00192	Low density lipoprotein-receptor
IPR002172	278	315	SM00192	Low density lipoprotein-receptor
IPR002172	317	354	SM00192	Low density lipoprotein-receptor
IPR006210	317	353	SM00181	EGF
IPR002172	359	399	SM00192	Low density lipoprotein-receptor
IPR006210	405	442	SM00181	EGF
IPR001881	443	482	SM00179	EGF-like calcium-binding
IPR006210	446	482	SM00181	EGF
IPR000033	508	550	SM00135	Low-density lipoprotein receptor
IPR000033	551	593	SM00135	Low-density lipoprotein receptor
IPR000033	594	637	SM00135	Low-density lipoprotein receptor
IPR000033	638	680	SM00135	Low-density lipoprotein receptor
IPR000033	681	722	SM00135	Low-density lipoprotein receptor
IPR001881	746	785	SM00179	EGF-like calcium-binding
IPR006210	749	785	SM00181	EGF
IPR000033	813	855	SM00135	Low-density lipoprotein receptor
IPR000033	856	898	SM00135	Low-density lipoprotein receptor
IPR000033	899	942	SM00135	Low-density lipoprotein receptor
IPR000033	943	985	SM00135	Low-density lipoprotein receptor
IPR000033	986	1027	SM00135	Low-density lipoprotein receptor
IPR006210	1053	1092	SM00181	EGF
IPR000033	1121	1163	SM00135	Low-density lipoprotein receptor
IPR000033	1164	1206	SM00135	Low-density lipoprotein receptor
IPR000033	1207	1250	SM00135	Low-density lipoprotein receptor
IPR000033	1251	1293	SM00135	Low-density lipoprotein receptor
IPR000033	1294	1333	SM00135	Low-density lipoprotein receptor
IPR001881	1357	1397	SM00179	EGF-like calcium-binding
IPR006210	1360	1397	SM00181	EGF
IPR000033	1425	1467	SM00135	Low-density lipoprotein receptor
IPR000033	1468	1510	SM00135	Low-density lipoprotein receptor
IPR000033	1511	1551	SM00135	Low-density lipoprotein receptor
IPR000033	1552	1594	SM00135	Low-density lipoprotein receptor
IPR000033	1595	1635	SM00135	Low-density lipoprotein receptor
IPR006210	1661	1694	SM00181	EGF
ProfileScan	IPR002172	74	115	PS50068	Low density lipoprotein-receptor
IPR002172	118	154	PS50068	Low density lipoprotein-receptor
IPR002172	157	192	PS50068	Low density lipoprotein-receptor
IPR002172	195	231	PS50068	Low density lipoprotein-receptor
IPR002172	238	274	PS50068	Low density lipoprotein-receptor
IPR002172	278	314	PS50068	Low density lipoprotein-receptor
IPR002172	317	353	PS50068	Low density lipoprotein-receptor
IPR002172	359	398	PS50068	Low density lipoprotein-receptor
IPR000033	528	570	PS51120	Low-density lipoprotein receptor
IPR000033	571	613	PS51120	Low-density lipoprotein receptor
IPR000033	614	657	PS51120	Low-density lipoprotein receptor
IPR000033	658	700	PS51120	Low-density lipoprotein receptor
IPR000033	701	741	PS51120	Low-density lipoprotein receptor
IPR000033	833	875	PS51120	Low-density lipoprotein receptor
IPR000033	876	918	PS51120	Low-density lipoprotein receptor
IPR000033	919	962	PS51120	Low-density lipoprotein receptor
IPR000033	963	1005	PS51120	Low-density lipoprotein receptor
IPR000033	1006	1046	PS51120	Low-density lipoprotein receptor
IPR000033	1141	1183	PS51120	Low-density lipoprotein receptor
IPR000033	1184	1226	PS51120	Low-density lipoprotein receptor
IPR000033	1227	1270	PS51120	Low-density lipoprotein receptor
IPR000033	1271	1312	PS51120	Low-density lipoprotein receptor
IPR000033	1313	1354	PS51120	Low-density lipoprotein receptor
IPR000033	1445	1487	PS51120	Low-density lipoprotein receptor
IPR000033	1488	1518	PS51120	Low-density lipoprotein receptor
IPR000033	1528	1571	PS51120	Low-density lipoprotein receptor
IPR000033	1572	1613	PS51120	Low-density lipoprotein receptor
IPR000033	1614	1655	PS51120	Low-density lipoprotein receptor
ScanRegExp	IPR002172	92	114	PS01209	Low density lipoprotein-receptor
IPR002172	131	153	PS01209	Low density lipoprotein-receptor
IPR002172	170	191	PS01209	Low density lipoprotein-receptor
IPR002172	208	230	PS01209	Low density lipoprotein-receptor
IPR002172	251	273	PS01209	Low density lipoprotein-receptor
IPR002172	291	313	PS01209	Low density lipoprotein-receptor
IPR002172	330	352	PS01209	Low density lipoprotein-receptor
IPR002172	372	397	PS01209	Low density lipoprotein-receptor
IPR013032	426	441	PS01186	EGF-like region
IPR001881	443	466	PS01187	EGF-like calcium-binding
IPR000152	457	468	PS00010	Aspartic acid and asparagine hydroxylation site
IPR013032	466	481	PS01186	EGF-like region
IPR013032	770	784	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 1770 SYAIGGLLSILLILVVIAALMLY 1792 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1770	SYAIGGLLSILLILVVIAALMLY	1792	PRIMARY	23

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: nakayama
Primer_f	: GAAAGTCCAATCTCTCCAGTG
Primer_r	: AAGAGCAAGTAGAAAAGTGGC
PCR product length	: 224 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2111 bp
Genome contig ID	gi51511727r_46734999
PolyA signal sequence (TATAAA,-19)	+--------+--------+----*----+---- CTTTATGATAATTTAATATAAATTTAGCTTTTCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCACCTTGCCTGGCTTGGAGTCATGACTAATCCTGCACCTGCTCTGTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	46834999	46896652	38	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0816

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information