| HUGE |
Gene/Protein Characteristic Table for KIAA0743 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00123 |
|---|---|
| Accession No. : | AB018286 |
| Description : | Neurexin-3-alpha precursor. |
| HUGO Gene Name : | neurexin 3 (NRXN3) |
| Clone Name : | hk04080 [Vector Info] |
| Flexi ORF Clone : | pF1KA0743
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4149 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1205 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR012680 | 58 | 184 | PF02210 | Laminin G |
| IPR012680 | 246 | 390 | PF02210 | Laminin G | |
| IPR006209 | 418 | 450 | PF00008 | EGF-like | |
| IPR012680 | 484 | 614 | PF02210 | Laminin G | |
| IPR012680 | 670 | 798 | PF02210 | Laminin G | |
| IPR006209 | 824 | 856 | PF00008 | EGF-like | |
| IPR012680 | 893 | 1012 | PF02210 | Laminin G | |
| HMMSmart | IPR001791 | 50 | 184 | SM00282 | Laminin G |
| IPR001791 | 238 | 390 | SM00282 | Laminin G | |
| IPR006210 | 417 | 451 | SM00181 | EGF | |
| IPR001791 | 476 | 614 | SM00282 | Laminin G | |
| IPR001791 | 662 | 798 | SM00282 | Laminin G | |
| IPR006210 | 823 | 857 | SM00181 | EGF | |
| IPR001791 | 885 | 1012 | SM00282 | Laminin G | |
| IPR003585 | 1151 | 1169 | SM00294 | Neurexin/syndecan/glycophorin C | |
| ProfileScan | IPR001791 | 29 | 211 | PS50025 | Laminin G |
| IPR001791 | 218 | 410 | PS50025 | Laminin G | |
| IPR000742 | 414 | 451 | PS50026 | EGF-like | |
| IPR001791 | 456 | 628 | PS50025 | Laminin G | |
| IPR001791 | 642 | 817 | PS50025 | Laminin G | |
| IPR000742 | 820 | 857 | PS50026 | EGF-like | |
| IPR001791 | 861 | 1031 | PS50025 | Laminin G | |
| ScanRegExp | IPR000152 | 429 | 440 | PS00010 | Aspartic acid and asparagine hydroxylation site |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| SOSUI2 | 1 | 1129 | TTGMVVGIVAAAALCILILLYA | 1150 | PRIMARY | 22 |
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : ACAAGGACAGGGAGTATTACG | |
| : CCCATTTCATAGTTCCAGCAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 14 |
| : UniGene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
