HUGE

Gene/Protein Characteristic Table for KIAA0578

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00566
Accession No. :	AB011150
Description :	Neurexin-1-alpha precursor.
HUGO Gene Name :	neurexin 1 (NRXN1)
Clone Name :	bf00990 [Vector Info]
Flexi ORF Clone :	pF1KSDA0578
Source :	Human adult brain
Note :	We replaced hj00406, former representative clones for KIAA0578 with bf00990. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 8114 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3440 bp

Genome contig ID gi89161199r_49899148
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TAAGTAAACCTGTGATTAAATTCCAACACTATCAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATACTCGTTACTATTTGCCTAATTTCTTTGACTCTCACATTGTGTTATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 49999148 51109098 19 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 1542 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50248	100.0	NRXN1 protein [...	Homo sapiens
XP_001114208	99.9	similar to neur...	Macaca mulatta
NP_064648	99.1	neurexin I [Mus...	Mus musculus
AAA41704	98.1	non-processed n...	Rattus norvegicus
XP_001375403	97.6	similar to neur...	Monodelphis dom...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018286	0	76.4	KIAA0743
AB023138	2.9e-162	59.7	KIAA0921
AB020675	1e-22	23.6	KIAA0868
AB051550	1.5e-21	25.1	KIAA1763
AB051501	1.8e-10	25.2	KIAA1714

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR012680 104 238 PF02210 Laminin G

IPR012680 358 484 PF02210 Laminin G

IPR012680 546 690 PF02210 Laminin G

IPR006209 718 750 PF00008 EGF-like

IPR012680 784 915 PF02210 Laminin G

IPR012680 971 1099 PF02210 Laminin G

IPR006209 1125 1157 PF00008 EGF-like

IPR012680 1194 1343 PF02210 Laminin G

HMMSmart IPR001791 96 238 SM00282 Laminin G

IPR006210 262 302 SM00181 EGF

IPR001791 350 484 SM00282 Laminin G

IPR001791 538 690 SM00282 Laminin G

IPR006210 717 751 SM00181 EGF

IPR001791 776 915 SM00282 Laminin G

IPR001791 963 1099 SM00282 Laminin G

IPR006210 1124 1158 SM00181 EGF

IPR001791 1186 1343 SM00282 Laminin G

IPR003585 1487 1505 SM00294 Neurexin/syndecan/glycophorin C

ProfileScan IPR001791 76 263 PS50025 Laminin G

IPR000742 265 302 PS50026 EGF-like

IPR001791 329 511 PS50025 Laminin G

IPR001791 518 710 PS50025 Laminin G

IPR000742 714 751 PS50026 EGF-like

IPR001791 756 929 PS50025 Laminin G

IPR001791 943 1118 PS50025 Laminin G

IPR000742 1121 1158 PS50026 EGF-like

IPR001791 1164 1362 PS50025 Laminin G

ScanRegExp IPR000152 729 740 PS00010 Aspartic acid and asparagine hydroxylation site

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012680	104	238	PF02210	Laminin G
IPR012680	358	484	PF02210	Laminin G
IPR012680	546	690	PF02210	Laminin G
IPR006209	718	750	PF00008	EGF-like
IPR012680	784	915	PF02210	Laminin G
IPR012680	971	1099	PF02210	Laminin G
IPR006209	1125	1157	PF00008	EGF-like
IPR012680	1194	1343	PF02210	Laminin G
HMMSmart	IPR001791	96	238	SM00282	Laminin G
IPR006210	262	302	SM00181	EGF
IPR001791	350	484	SM00282	Laminin G
IPR001791	538	690	SM00282	Laminin G
IPR006210	717	751	SM00181	EGF
IPR001791	776	915	SM00282	Laminin G
IPR001791	963	1099	SM00282	Laminin G
IPR006210	1124	1158	SM00181	EGF
IPR001791	1186	1343	SM00282	Laminin G
IPR003585	1487	1505	SM00294	Neurexin/syndecan/glycophorin C
ProfileScan	IPR001791	76	263	PS50025	Laminin G
IPR000742	265	302	PS50026	EGF-like
IPR001791	329	511	PS50025	Laminin G
IPR001791	518	710	PS50025	Laminin G
IPR000742	714	751	PS50026	EGF-like
IPR001791	756	929	PS50025	Laminin G
IPR001791	943	1118	PS50025	Laminin G
IPR000742	1121	1158	PS50026	EGF-like
IPR001791	1164	1362	PS50025	Laminin G
ScanRegExp	IPR000152	729	740	PS00010	Aspartic acid and asparagine hydroxylation site

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 53 QRGGCFLLCLSLLLLGCWAELGS 75 PRIMARY 23

2 1465 TTGMVVGIVAAAALCILILLYA 1486 PRIMARY 22

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	53	QRGGCFLLCLSLLLLGCWAELGS	75	PRIMARY	23
2	1465	TTGMVVGIVAAAALCILILLYA	1486	PRIMARY	22

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AAGATCCAAACGTGCATACAG

Primer_r
: TTGCTTCCATAACCTGCCCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGATCCAAACGTGCATACAG
Primer_r	: TTGCTTCCATAACCTGCCCAC
PCR product length	: 240 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3440 bp
Genome contig ID	gi89161199r_49899148
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TAAGTAAACCTGTGATTAAATTCCAACACTATCAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATACTCGTTACTATTTGCCTAATTTCTTTGACTCTCACATTGTGTTATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	49999148	51109098	19	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0578

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information