HUGE

Gene/Protein Characteristic Table for KIAA0921

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00683
Accession No. :	AB023138
Description :	Neurexin-2-alpha precursor.
HUGO Gene Name :
Clone Name :	ah00573 [Vector Info]
Flexi ORF Clone :	pF1KSDA0921
Source :	Human brain (amygdala)
Note :	We replaced hh02750, former representative clones for KIAA0921 with ah00573. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5502 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 134 bp

Genome contig ID gi51511727r_64031110
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGCTGCCTCAGGCTTCTCTTACGAAGAGGAAACGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAAAAGGAAAAACCCCGTGCTCGCCCCCTTCCTCCTGCCGTCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 64131110 64247236 21 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1658 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50276	100.0	Neurexin 2 [Hom...	Homo sapiens
XP_001254001	98.4	similar to neur...	Bos taurus
XP_540881	96.1	similar to neur...	Canis lupus fam...
XP_508530	98.2	neurexin 2 isof...	Pan troglodytes
XP_001166041	66.6	neurexin 3 isof...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018286	1.3e-131	61.4	KIAA0743
AB011150	4.9e-87	59.8	KIAA0578
AB051550	3.8e-11	26.0	KIAA1763
AB051501	1.9e-09	26.5	KIAA1714
AB020675	2.3e-05	24.4	KIAA0868

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR012680 73 203 PF02210 Laminin G

IPR006209 222 257 PF00008 EGF-like

IPR012680 310 444 PF02210 Laminin G

IPR012680 506 651 PF02210 Laminin G

IPR006209 679 711 PF00008 EGF-like

IPR012680 745 866 PF02210 Laminin G

IPR012680 922 1050 PF02210 Laminin G

IPR006209 1076 1108 PF00008 EGF-like

IPR012680 1145 1264 PF02210 Laminin G

HMMSmart IPR001791 65 203 SM00282 Laminin G

IPR006210 221 258 SM00181 EGF

IPR001791 302 444 SM00282 Laminin G

IPR001791 498 651 SM00282 Laminin G

IPR006210 678 712 SM00181 EGF

IPR001791 737 866 SM00282 Laminin G

IPR001791 914 1050 SM00282 Laminin G

IPR006210 1075 1109 SM00181 EGF

IPR001791 1137 1264 SM00282 Laminin G

IPR003585 1603 1621 SM00294 Neurexin/syndecan/glycophorin C

ProfileScan IPR001791 44 222 PS50025 Laminin G

IPR000742 218 258 PS50026 EGF-like

IPR001791 281 471 PS50025 Laminin G

IPR001791 478 671 PS50025 Laminin G

IPR000742 675 712 PS50026 EGF-like

IPR001791 717 880 PS50025 Laminin G

IPR001791 894 1069 PS50025 Laminin G

IPR000742 1072 1109 PS50026 EGF-like

IPR001791 1113 1291 PS50025 Laminin G

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012680	73	203	PF02210	Laminin G
IPR006209	222	257	PF00008	EGF-like
IPR012680	310	444	PF02210	Laminin G
IPR012680	506	651	PF02210	Laminin G
IPR006209	679	711	PF00008	EGF-like
IPR012680	745	866	PF02210	Laminin G
IPR012680	922	1050	PF02210	Laminin G
IPR006209	1076	1108	PF00008	EGF-like
IPR012680	1145	1264	PF02210	Laminin G
HMMSmart	IPR001791	65	203	SM00282	Laminin G
IPR006210	221	258	SM00181	EGF
IPR001791	302	444	SM00282	Laminin G
IPR001791	498	651	SM00282	Laminin G
IPR006210	678	712	SM00181	EGF
IPR001791	737	866	SM00282	Laminin G
IPR001791	914	1050	SM00282	Laminin G
IPR006210	1075	1109	SM00181	EGF
IPR001791	1137	1264	SM00282	Laminin G
IPR003585	1603	1621	SM00294	Neurexin/syndecan/glycophorin C
ProfileScan	IPR001791	44	222	PS50025	Laminin G
IPR000742	218	258	PS50026	EGF-like
IPR001791	281	471	PS50025	Laminin G
IPR001791	478	671	PS50025	Laminin G
IPR000742	675	712	PS50026	EGF-like
IPR001791	717	880	PS50025	Laminin G
IPR001791	894	1069	PS50025	Laminin G
IPR000742	1072	1109	PS50026	EGF-like
IPR001791	1113	1291	PS50025	Laminin G

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 28 PPLLLLLLLALAARADGLEF 47 SECONDARY 20

2 1580 STTGMVVGIVAAAALCILILLYA 1602 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	28	PPLLLLLLLALAARADGLEF	47	SECONDARY	20
2	1580	STTGMVVGIVAAAALCILILLYA	1602	PRIMARY	23

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TAGATTCCACGAGCAGCAGCC

Primer_r
: GGTGTTTTCCAAGACTCAGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGTGTTTTCCAAGACTCAGAC
Primer_r	: TAGATTCCACGAGCAGCAGCC
PCR product length	: 171 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	134 bp
Genome contig ID	gi51511727r_64031110
PolyA signal sequence (None)	+--------+--------+----*----+---- GGCTGCCTCAGGCTTCTCTTACGAAGAGGAAACGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAGGAAAAACCCCGTGCTCGCCCCCTTCCTCCTGCCGTCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	64131110	64247236	21	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0921

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information