HUGE

Gene/Protein Characteristic Table for KIAA1714

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01178
Accession No. :	AB051501
Description :	Contactin-associated protein-like 3 precursor.
HUGO Gene Name :	contactin associated protein-like 3 (CNTNAP3)
Clone Name :	fj19060y1 [Vector Info]
Flexi ORF Clone :	pF1KA1714
Source :	Human fetal brain
Note :	We replaced fj19060, former representative clones for KIAA1714 with fj19060y1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 5248 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1718 bp

Genome contig ID gi89161216r_38974974
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
CATCTTTGTTTCCTTCCAAATAAAGGAGAACATGG
Flanking genome sequence
(99995 - 99946)
----+----*----+----*----+----*----+----*----+----*
AATTGAAGGTGTTAATGTTTTCATTCAAGGATGGTATATTCAAAGGCATG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 39074969 40623428 21 99.0 Perfect prediction

ContigView(URL based/DAS) 9 f 43625145 43849289 20 97.9 Perfect prediction

ContigView(URL based/DAS) 9 f 65316728 65390684 12 97.6 Internal No-hit

Features of the protein sequence	Description

Length: 1175 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI12626	98.0	contactin assoc...	Homo sapiens
BAG11354	100.0	contactin-assoc...	synthetic construct
Q9BZ76	99.3	Contactin-assoc...	Homo sapiens
AAG52889	98.8	cell recognitio...	Homo sapiens
XP_001142532	98.4	cell recognitio...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051550	0	72.3	KIAA1763
AB020675	4.5e-212	48.3	KIAA0868
AB018286	1.7e-22	26.3	KIAA0743
AB023138	1.9e-20	26.6	KIAA0921
AB011150	7.3e-11	25.1	KIAA0578

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000421 91 222 PF00754 Coagulation factor 5/8 type

IPR012680 260 389 PF02210 Laminin G

IPR012680 446 570 PF02210 Laminin G

IPR006209 599 631 PF00008 EGF-like

IPR012680 869 988 PF02210 Laminin G

IPR006209 1010 1044 PF00008 EGF-like

IPR012680 1094 1167 PF02210 Laminin G

HMMSmart IPR000421 78 225 SM00231 Coagulation factor 5/8 type

IPR001791 252 389 SM00282 Laminin G

IPR001791 438 570 SM00282 Laminin G

IPR006210 598 632 SM00181 EGF

IPR001791 861 988 SM00282 Laminin G

IPR006210 1009 1045 SM00181 EGF

ProfileScan IPR000421 79 225 PS50022 Coagulation factor 5/8 type

IPR001791 231 412 PS50025 Laminin G

IPR001791 418 593 PS50025 Laminin G

IPR000742 595 632 PS50026 EGF-like

IPR001791 841 1006 PS50025 Laminin G

IPR000742 1007 1045 PS50026 EGF-like

IPR001791 1063 1175 PS50025 Laminin G

ScanRegExp IPR000421 117 146 PS01285 Coagulation factor 5/8 type

IPR000421 207 225 PS01286 Coagulation factor 5/8 type

IPR001545 1006 1012 PS00261 Gonadotropin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000421	91	222	PF00754	Coagulation factor 5/8 type
IPR012680	260	389	PF02210	Laminin G
IPR012680	446	570	PF02210	Laminin G
IPR006209	599	631	PF00008	EGF-like
IPR012680	869	988	PF02210	Laminin G
IPR006209	1010	1044	PF00008	EGF-like
IPR012680	1094	1167	PF02210	Laminin G
HMMSmart	IPR000421	78	225	SM00231	Coagulation factor 5/8 type
IPR001791	252	389	SM00282	Laminin G
IPR001791	438	570	SM00282	Laminin G
IPR006210	598	632	SM00181	EGF
IPR001791	861	988	SM00282	Laminin G
IPR006210	1009	1045	SM00181	EGF
ProfileScan	IPR000421	79	225	PS50022	Coagulation factor 5/8 type
IPR001791	231	412	PS50025	Laminin G
IPR001791	418	593	PS50025	Laminin G
IPR000742	595	632	PS50026	EGF-like
IPR001791	841	1006	PS50025	Laminin G
IPR000742	1007	1045	PS50026	EGF-like
IPR001791	1063	1175	PS50025	Laminin G
ScanRegExp	IPR000421	117	146	PS01285	Coagulation factor 5/8 type
IPR000421	207	225	PS01286	Coagulation factor 5/8 type
IPR001545	1006	1012	PS00261	Gonadotropin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 44 LAEVSMASVAWAVLKVLLLLPT 65 PRIMARY 22

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	44	LAEVSMASVAWAVLKVLLLLPT	65	PRIMARY	22

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TACCTTTCAGTTATCCTCGCC

Primer_r
: GTTTGACTTCTGCATTTGTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: CCR
Primer_f	: TACCTTTCAGTTATCCTCGCC
Primer_r	: GTTTGACTTCTGCATTTGTGG
PCR product length	: 189(1.6k) bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1718 bp
Genome contig ID	gi89161216r_38974974
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CATCTTTGTTTCCTTCCAAATAAAGGAGAACATGG
Flanking genome sequence (99995 - 99946)	----+--------+--------+--------+--------+----* AATTGAAGGTGTTAATGTTTTCATTCAAGGATGGTATATTCAAAGGCATG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	39074969	40623428	21	99.0	Perfect prediction
ContigView(URL based/DAS)	9	f	43625145	43849289	20	97.9	Perfect prediction
ContigView(URL based/DAS)	9	f	65316728	65390684	12	97.6	Internal No-hit

Gene/Protein Characteristic Table for KIAA1714

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information