ROUGE |
Gene/Protein Characteristic Table for mKIAA0581 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129166 |
---|---|
1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase beta 1. | |
mbg02025 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5977 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3221 bp Genome contig ID gi66880554f_134676033 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
ATTGTCCAAAGGAAACAATAAAAATTTCTTAACACFlanking genome sequence
(313079 - 313128) ----+----*----+----*----+----*----+----*----+----*
AGTCCAGCTGGACCTTCTTAGAGTCACAGCCCACTTTACAGGGGTCAGTG
KIAA Alignment based on: KIAA0581 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 3..2657, 2770..3003
Length: 962 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |