Order Kazusa clone(s) from : ![]() |
Product ID | ORK02010 |
---|---|
Accession No | AB023217 |
Description | myosin, heavy chain 15 |
Clone name | hk09604y2 |
Vector information | |
cDNA sequence | DNA sequence (7074 bp) Predicted protein sequence (1956 aa) |
Flexi ORF Clone | FXC02010 |
Source | Human adult brain |
Note | We replaced hk09604y1 and hk09604, former representative clones for KIAA1000 with hk09604y2. (2008/2/6,2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1176 bp |
---|---|
Genome contig ID | gi89161205r_109482235 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99671 - 99622) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 109581906 | 109730859 | 42 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001609 | 240 | 275 | PD000355 | Myosin head |
FPrintScan | IPR001609 | 143 | 162 | PR00193 | Myosin head |
IPR001609 | 199 | 224 | PR00193 | Myosin head | |
IPR001609 | 248 | 275 | PR00193 | Myosin head | |
IPR001609 | 478 | 506 | PR00193 | Myosin head | |
IPR001609 | 532 | 560 | PR00193 | Myosin head | |
HMMPfam | IPR004009 | 61 | 103 | PF02736 | Myosin |
IPR001609 | 115 | 788 | PF00063 | Myosin head | |
IPR002928 | 1090 | 1948 | PF01576 | Myosin tail | |
HMMSmart | IPR001609 | 107 | 801 | SM00242 | Myosin head |
Primer_f | GGGTTCTGTTTGTTCTTATGG |
---|---|
Primer_r | GTGCTGGTGGAGAAGTCTAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGGTTCTGTTTGTTCTTATGG |
Primer_r | GTGCTGGTGGAGAAGTCTAGG |
PCR product length | 123 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |