KIAA1119

Product ID	ORK01152
Accession No	AB032945
Description	myosin VB
Clone name	hf00569y1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hf00569y1 has an irregular adapter sequence (GTCGACCCAC GCGTCCGTAA TACGACTCAC TATAGGGCGA ATTGGGTACC GGGCCCCCAC TCGAGGTCGA CCCACGCGTC CG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (9220 bp) Predicted protein sequence (1854 aa)
HaloTag ORF Clone	FHC01152
Flexi ORF Clone	FXC01152
Source	Human adult brain
Rouge ID	mKIAA1119 by Kazusa Mouse cDNA Project
Note	We replaced hf00569, former representative clones for KIAA1119 with hf00569y1. (2003/4/2)

Length: 9220 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3655 bp
Genome contig ID	gi51511735r_45503184
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- TGGATAAAAATTTGTGGAAATAAATACTTTTGAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGAGGTGTGCCAAATCTAAATGAAATTTAAAACTCTGCAGCTACAGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	r	45603184	45835749	39	99.5	Terminal No-hit

Length: 1854 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULV0	100.0	Myosin-Vb.	Homo sapiens
NP_001073936	99.9	myosin VB [Homo...	Homo sapiens
XP_001090434	97.2	myosin VB isofo...	Macaca mulatta
XP_001499210	93.7	similar to Myos...	Equus caballus
EDL09522	90.2	myosin Vb, isof...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020673	1e-55	28.1	KIAA0866
AB023217	2.3e-49	30.6	KIAA1000
AB040945	9.4e-44	30.3	KIAA1512
AB018342	3.2e-38	34.0	KIAA0799
AB018270	1e-31	34.3	KIAA0727

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001609	198	228	PD000355	Myosin head
BlastProDom	IPR002710	1613	1747	PD003376	Dilute
FPrintScan	IPR001609	105	124	PR00193	Myosin head
	IPR001609	161	186	PR00193	Myosin head
	IPR001609	206	233	PR00193	Myosin head
	IPR001609	438	466	PR00193	Myosin head
	IPR001609	491	519	PR00193	Myosin head
HMMPfam	IPR001609	76	754	PF00063	Myosin head
	IPR000048	770	790	PF00612	IQ calmodulin-binding region
	IPR000048	793	813	PF00612	IQ calmodulin-binding region
	IPR000048	818	838	PF00612	IQ calmodulin-binding region
	IPR000048	841	861	PF00612	IQ calmodulin-binding region
	IPR000048	866	886	PF00612	IQ calmodulin-binding region
	IPR000048	889	909	PF00612	IQ calmodulin-binding region
	IPR002710	1686	1791	PF01843	Dilute
HMMSmart	IPR001609	68	767	SM00242	Myosin head
	IPR000048	768	790	SM00015	IQ calmodulin-binding region
	IPR000048	791	813	SM00015	IQ calmodulin-binding region
	IPR000048	816	838	SM00015	IQ calmodulin-binding region
	IPR000048	839	861	SM00015	IQ calmodulin-binding region
	IPR000048	864	886	SM00015	IQ calmodulin-binding region
	IPR000048	887	909	SM00015	IQ calmodulin-binding region
ProfileScan	IPR000048	770	798	PS50096	IQ calmodulin-binding region
	IPR000048	792	821	PS50096	IQ calmodulin-binding region
	IPR000048	817	843	PS50096	IQ calmodulin-binding region
	IPR000048	841	869	PS50096	IQ calmodulin-binding region
	IPR000048	865	891	PS50096	IQ calmodulin-binding region
	IPR000048	888	917	PS50096	IQ calmodulin-binding region
	IPR002710	1532	1809	PS51126	Dilute

Primer_f	CAACTACAAGAGCGGAATGAC
Primer_r	GCATCTTCAGACTTCATTGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-