KIAA1775

Product ID	ORK02053
Accession No	AB053448
Description	cadherin-related family member 1, transcript variant 1
Clone name	hk03826
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4483 bp) Predicted protein sequence (858 aa)
HaloTag ORF Clone	FHC02053
Flexi ORF Clone	FXC02053
Source	Human adult brain
Rouge ID	mKIAA1775 by Kazusa Mouse cDNA Project

Length: 4483 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1904 bp
Genome contig ID	gi89161187f_85844498
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTGTAAATGGAAAATAAAGTCTGTTACCCAAAGGC
Flanking genome sequence (121765 - 121814)	----+--------+--------+--------+--------+----* CATGCTGATCCCCTGCTCCCTGCTTTCATTTATGTTTGCTGACCTGTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	85944498	85966261	17	99.4	Perfect prediction

Length: 858 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96JP9	100.0	Protocadherin-2...	Homo sapiens
EAW80364	99.2	protocadherin 2...	Homo sapiens
XP_001154359	99.4	protocadherin 2...	Pan troglodytes
XP_001086534	95.2	similar to prot...	Macaca mulatta
Q8WN91	85.6	Protocadherin-2...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB053446	4.5e-19	29.9	KIAA1773
D87469	1.4e-11	30.3	KIAA0279
AB160984	2e-09	27.2	KIAA0811
AB046841	1.2e-07	25.4	KIAA1621
AB037821	1.4e-07	24.5	KIAA1400

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	78	97	PR00205	Cadherin
	IPR002126	134	163	PR00205	Cadherin
	IPR002126	204	216	PR00205	Cadherin
	IPR002126	224	243	PR00205	Cadherin
	IPR002126	243	256	PR00205	Cadherin
	IPR002126	418	444	PR00205	Cadherin
	IPR002126	453	470	PR00205	Cadherin
HMMPfam	IPR002126	39	112	PF00028	Cadherin
	IPR002126	139	236	PF00028	Cadherin
	IPR002126	250	343	PF00028	Cadherin
	IPR002126	362	462	PF00028	Cadherin
	IPR002126	476	566	PF00028	Cadherin
	IPR002126	577	676	PF00028	Cadherin
HMMSmart	IPR002126	56	132	SM00112	Cadherin
	IPR002126	156	243	SM00112	Cadherin
	IPR002126	267	350	SM00112	Cadherin
	IPR002126	381	469	SM00112	Cadherin
	IPR002126	493	573	SM00112	Cadherin
	IPR002126	592	683	SM00112	Cadherin
ProfileScan	IPR002126	41	134	PS50268	Cadherin
	IPR002126	135	245	PS50268	Cadherin
	IPR002126	246	352	PS50268	Cadherin
	IPR002126	358	471	PS50268	Cadherin
	IPR002126	472	575	PS50268	Cadherin
	IPR002126	587	687	PS50268	Cadherin
ScanRegExp	IPR002126	459	469	PS00232	Cadherin
ScanRegExp	IPR002126	563	573	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	4	RWAALALGLLRLCLAQANFAPHF	26	SECONDARY	23
SOSUI2	2	700	AVGVLAGTMATVVAITVLISTAT	722	PRIMARY	23

Primer_f	TACAGTCCCCAACGTGAACAG
Primer_r	AAGCATGATCCAGCACAGTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TACAGTCCCCAACGTGAACAG
Primer_r	AAGCATGATCCAGCACAGTCC
PCR product length	122 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles