KIAA0811

Product ID	ORK04990
Accession No	AB160984
Description	FAT atypical cadherin 2
Clone name	hj04806
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4846 bp) Predicted protein sequence (1123 aa)
Source	Human adult brain
Rouge ID	mKIAA0811 by Kazusa Mouse cDNA Project

Length: 4846 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1473 bp
Genome contig ID	gi51511721r_150763955
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTTTTTTTAACAATAAAGTATCTTTTTTTACTGTT
Flanking genome sequence (99892 - 99843)	----+--------+--------+--------+--------+----* ATTTTCTGTGTCCTTTAGCCTGTTTGGGGTCAGGGGAACGATGCAAGGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	150863847	150891731	11	99.3	Perfect prediction

Length: 1123 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NYQ8	92.8	Protocadherin F...	Homo sapiens
NP_001438	92.8	FAT tumor suppr...	Homo sapiens
EAW61673	92.6	FAT tumor suppr...	Homo sapiens
XP_001168406	91.9	FAT tumor suppr...	Pan troglodytes
XP_001110265	89.1	similar to FAT ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87469	2.1e-22	26.1	KIAA0279
AB076400	3.3e-19	27.4	KIAA1989
AB053446	3.4e-18	32.5	KIAA1773
AB002325	9.6e-18	33.5	KIAA0327
AB053445	5.7e-16	31.1	KIAA1774

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	122	141	PR00205	Cadherin
	IPR002126	181	210	PR00205	Cadherin
	IPR002126	251	263	PR00205	Cadherin
	IPR002126	265	284	PR00205	Cadherin
	IPR002126	284	297	PR00205	Cadherin
	IPR002126	339	365	PR00205	Cadherin
	IPR002126	373	390	PR00205	Cadherin
HMMPfam	IPR002126	1	69	PF00028	Cadherin
	IPR002126	83	172	PF00028	Cadherin
	IPR002126	186	277	PF00028	Cadherin
	IPR002126	291	382	PF00028	Cadherin
	IPR002126	396	480	PF00028	Cadherin
	IPR006209	725	757	PF00008	EGF-like
	IPR006209	764	795	PF00008	EGF-like
HMMSmart	IPR002126	1	76	SM00112	Cadherin
	IPR002126	101	179	SM00112	Cadherin
	IPR002126	203	284	SM00112	Cadherin
	IPR002126	308	389	SM00112	Cadherin
	IPR002126	413	487	SM00112	Cadherin
	IPR001881	721	758	SM00179	EGF-like calcium-binding
	IPR006210	724	758	SM00181	EGF
	IPR001881	761	796	SM00179	EGF-like calcium-binding
	IPR006210	763	796	SM00181	EGF
ProfileScan	IPR002126	1	78	PS50268	Cadherin
	IPR002126	79	181	PS50268	Cadherin
	IPR002126	182	286	PS50268	Cadherin
	IPR002126	287	391	PS50268	Cadherin
	IPR002126	392	502	PS50268	Cadherin
	IPR000742	721	758	PS50026	EGF-like
	IPR000742	760	796	PS50026	EGF-like
ScanRegExp	IPR002126	274	284	PS00232	Cadherin
	IPR013032	746	757	PS00022	EGF-like region
	IPR013032	784	795	PS00022	EGF-like region
	IPR013032	784	795	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	822	ELLIITVAVAFIIISTVGLLFYC	844	PRIMARY	23

Primer_f	ACTCACACAAATTGGCTCTCG
Primer_r	GGTCCACTGCCTTTTCATATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-