KIAA0239

Product ID	ORK00474
Accession No	D87076
Description	jade family PHD finger 2, transcript variant 3
Clone name	ha06313
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6466 bp) Predicted protein sequence (849 aa)
HaloTag ORF Clone	FHC00474
Flexi ORF Clone	FXC00474
Source	Human adult brain
Rouge ID	mKIAA0239 by Kazusa Mouse cDNA Project
Note	We replaced ha02778, former representative clones for KIAA0239 with ha06313. (2002/12/27)

Length: 6466 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3914 bp
Genome contig ID	gi51511721f_133789697
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GGCAAACGCAGTTAATAAAGCAATGTTTTCTGTGC
Flanking genome sequence (157122 - 157171)	----+--------+--------+--------+--------+----* TGGCTGGTGTGAGGCTCCATTGCATTGGATGGGGTAGGGAACCCTGGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	133889697	133946817	11	99.2	Perfect prediction

Length: 849 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09672	100.0	PHD finger prot...	synthetic construct
Q9NQC1	99.9	Protein Jade-2;...	Homo sapiens
BAF83160	99.7	unnamed protein...	Homo sapiens
AAH21962	99.7	PHF15 protein [...	Homo sapiens
BAF85324	99.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86969	1.1e-41	42.7	KIAA0215
AB058710	3.5e-30	49.4	KIAA1807
AB033112	1.5e-11	31.1	KIAA1286
AB020683	6.4e-06	38.0	KIAA0876
AB018326	2.3e-05	24.9	KIAA0783

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	260	308	PF00628	Zinc finger
HMMSmart	IPR001965	260	306	SM00249	Zinc finger
HMMSmart	IPR001965	369	424	SM00249	Zinc finger
ProfileScan	IPR001965	258	308	PS50016	Zinc finger
ScanRegExp	IPR001965	261	305	PS01359	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TGCTACGGGATCCTCAAGGTG
Primer_r	CAGCTGACATGCACCCACTTG
PCR product length	146 bp
PCR conditions	95 °C15 sec68 °C60 sec30 cycles