Order Kazusa clone(s) from : ![]() |
Product ID | ORK05971 |
---|---|
Accession No | AB095929 |
Description | mex-3 RNA binding family member B |
Clone name | fj05611 |
Vector information | |
cDNA sequence | DNA sequence (4333 bp) Predicted protein sequence (501 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA2009
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1373 bp |
---|---|
Genome contig ID | gi51511731r_80021183 |
PolyA signal sequence (AATAAA,-15) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 80121183 | 80125515 | 1 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR004088 | 16 | 59 | PF00013 | K Homology |
IPR004088 | 94 | 153 | PF00013 | K Homology | |
IPR001841 | 450 | 489 | PF00097 | Zinc finger | |
HMMSmart | IPR004087 | 2 | 64 | SM00322 | K Homology |
IPR004087 | 91 | 158 | SM00322 | K Homology | |
IPR001841 | 450 | 489 | SM00184 | Zinc finger | |
ProfileScan | IPR004088 | 92 | 153 | PS50084 | K Homology |
IPR001841 | 450 | 490 | PS50089 | Zinc finger |
![]() |
Primer_f | TACATCAAGACCCCAGTTCGC |
---|---|
Primer_r | TGAGTGCCGTGTTCTTATTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |