ROUGE |
Gene/Protein Characteristic Table for mKIAA2009 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173330 |
---|---|
mph00181 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3435 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 573 bp Genome contig ID gi65511124f_76623872 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TTAAAGTTAAAACTGTAACATATCTCTTATATATTFlanking genome sequence
(103436 - 103485) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAACCTTTAAAAGTTTTAAAGAGAAATTGCATTAATACAGAT
KIAA Alignment based on: KIAA2009 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..612, 1366..2862
Length: 702 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |