KIAA2031

Product ID	ORK05974
Accession No	AB107353
Description	mex-3 RNA binding family member D
Clone name	ef03841
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (2441 bp) Predicted protein sequence (515 aa)
Source

Length: 2441 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	892 bp
Genome contig ID	gi42406306r_1405672
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AAAGCCTTCTTAATAAAGCCTCTTTTCTACATGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCACACGGCTTCAGCGTGGTGTGGGGGATGGGCACCAGGAGGGGAGACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	1505672	1518650	2	99.1	Perfect prediction

Length: 515 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86XN8	4.3e-170	100.0	RNA-binding pro...	Homo sapiens
XP_524036	6.1e-167	99.0	ring finger and...	Pan troglodytes
AAI13385	2.4e-154	99.6	MEX3D protein [...	Homo sapiens
AAQ04763	5.4e-154	99.6	bcl-2 ARE RNA b...	Homo sapiens
XP_583835	3.4e-127	86.0	similar to RNA-...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095929	1.2e-25	50.4	KIAA2009

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004088	44	104	PF00013	K Homology
	IPR004088	139	198	PF00013	K Homology
	IPR001841	464	503	PF00097	Zinc finger
HMMSmart	IPR004087	41	109	SM00322	K Homology
HMMSmart	IPR004087	136	203	SM00322	K Homology
ProfileScan	IPR004088	52	104	PS50084	K Homology
	IPR004088	137	198	PS50084	K Homology
	IPR001841	464	504	PS50089	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-