Order Kazusa clone(s) from : 
Japan
||
Other countries |
|
Order Kazusa clone(s) from :
Japan
||
Other countries |
| Product ID | ORK07719 |
|---|---|
| Accession No | AB051550 |
| Description | contactin associated protein-like 4, transcript variant 1 |
| Clone name | fj06918y2 |
| Vector information |
The cDNA fragment was inserted at SmaI-NotI site of the
|
| cDNA sequence | DNA sequence (4692 bp) Predicted protein sequence (1322 aa) |
|
HaloTag ORF Clone |
FHC07719
|
| Flexi ORF Clone | FXC07719 |
| Source | Human fetal brain |
| Rouge ID |
mKIAA1763
by Kazusa Mouse cDNA Project
|
| Note | We replaced fj06918y1 and fj06918, former representative clones for KIAA1763 with fj06918y2. (2008/8/27,2003/4/2) This clone must be cultured at 30oC, not 37oC. |
Length: 4692 bp Physical map
Restriction map Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 380 bp |
|---|---|
| Genome contig ID | gi51511732f_74768677 |
| PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (381786 - 381835) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 16 | f | 74868677 | 75150461 | 24 | 99.8 | Perfect prediction |
Length: 1322 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI) Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR000421 | 57 | 188 | PF00754 | Coagulation factor 5/8 type |
| IPR012680 | 226 | 355 | PF02210 | Laminin G | |
| IPR012680 | 412 | 538 | PF02210 | Laminin G | |
| IPR006209 | 567 | 599 | PF00008 | EGF-like | |
| IPR012680 | 835 | 954 | PF02210 | Laminin G | |
| IPR006209 | 976 | 1010 | PF00008 | EGF-like | |
| IPR012680 | 1060 | 1190 | PF02210 | Laminin G | |
| HMMSmart | IPR000421 | 44 | 191 | SM00231 | Coagulation factor 5/8 type |
| IPR001791 | 218 | 355 | SM00282 | Laminin G | |
| IPR001791 | 404 | 538 | SM00282 | Laminin G | |
| IPR006210 | 566 | 600 | SM00181 | EGF | |
| IPR001791 | 827 | 954 | SM00282 | Laminin G | |
| IPR006210 | 975 | 1011 | SM00181 | EGF | |
| IPR001791 | 1052 | 1190 | SM00282 | Laminin G | |
| ProfileScan | IPR000421 | 45 | 191 | PS50022 | Coagulation factor 5/8 type |
| IPR001791 | 197 | 378 | PS50025 | Laminin G | |
| IPR001791 | 384 | 561 | PS50025 | Laminin G | |
| IPR000742 | 563 | 600 | PS50026 | EGF-like | |
| IPR001791 | 807 | 972 | PS50025 | Laminin G | |
| IPR000742 | 973 | 1011 | PS50026 | EGF-like | |
| IPR001791 | 1023 | 1216 | PS50025 | Laminin G | |
| ScanRegExp | IPR000421 | 83 | 112 | PS01285 | Coagulation factor 5/8 type |
| IPR000421 | 173 | 191 | PS01286 | Coagulation factor 5/8 type |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 14 | NMGSVTGAVLKTLLLLSTQNWN | 35 | SECONDARY | 22 | 2 | 1254 | SAVIGGLIAVVIFILLCITAIAV | 1276 | PRIMARY | 23 |
|---|
Experimental conditions| Primer_f | TCAACAGTCAGCTCTTCGTGG |
|---|---|
| Primer_r | CATAACTTCCCATAGCTGCTG |
| PCR conditions | 95 °C 30 sec55 °C30 sec72 °C60 sec30 cycles |
Chromosome No. 16 Experimental conditions| Panel name | CCR |
|---|---|
| Primer_f | CCTCGTCCAGTGATATATTTC |
| Primer_r | GACCAAGGCTACAGTTTTCAC |
| PCR product length | 152 bp |
| PCR conditions | 95 °C15 sec62 °C60 sec35 cycles |
Japan
||
Other countries
