KIAA1714

Product ID	ORK01178
Accession No	AB051501
Description	contactin associated protein-like 3
Clone name	fj19060y1
Vector information	The cDNA fragment was originally inserted at Sal I-NotI site ... The cDNA fragment was originally inserted at Sal I-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GTCGACCCAC GCGTCCG-5' end of cDNA.
cDNA sequence	DNA sequence (5248 bp) Predicted protein sequence (1175 aa)
HaloTag ORF Clone	FHC01178
Flexi ORF Clone	FXC01178
Source	Human fetal brain
Note	We replaced fj19060, former representative clones for KIAA1714 with fj19060y1. (2002/12/27)

Length: 5248 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1718 bp
Genome contig ID	gi89161216r_38974974
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CATCTTTGTTTCCTTCCAAATAAAGGAGAACATGG
Flanking genome sequence (99995 - 99946)	----+--------+--------+--------+--------+----* AATTGAAGGTGTTAATGTTTTCATTCAAGGATGGTATATTCAAAGGCATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	39074969	40623428	21	99.0	Perfect prediction
Ensembl gnome browser	9	f	43625145	43849289	20	97.9	Perfect prediction
Ensembl gnome browser	9	f	65316728	65390684	12	97.6	Internal No-hit

Length: 1175 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI12626	98.0	contactin assoc...	Homo sapiens
BAG11354	100.0	contactin-assoc...	synthetic construct
Q9BZ76	99.3	Contactin-assoc...	Homo sapiens
AAG52889	98.8	cell recognitio...	Homo sapiens
XP_001142532	98.4	cell recognitio...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051550	0	72.3	KIAA1763
AB020675	4.5e-212	48.3	KIAA0868
AB018286	1.7e-22	26.3	KIAA0743
AB023138	1.9e-20	26.6	KIAA0921
AB011150	7.3e-11	25.1	KIAA0578

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000421	91	222	PF00754	Coagulation factor 5/8 type
	IPR012680	260	389	PF02210	Laminin G
	IPR012680	446	570	PF02210	Laminin G
	IPR006209	599	631	PF00008	EGF-like
	IPR012680	869	988	PF02210	Laminin G
	IPR006209	1010	1044	PF00008	EGF-like
	IPR012680	1094	1167	PF02210	Laminin G
HMMSmart	IPR000421	78	225	SM00231	Coagulation factor 5/8 type
	IPR001791	252	389	SM00282	Laminin G
	IPR001791	438	570	SM00282	Laminin G
	IPR006210	598	632	SM00181	EGF
	IPR001791	861	988	SM00282	Laminin G
	IPR006210	1009	1045	SM00181	EGF
ProfileScan	IPR000421	79	225	PS50022	Coagulation factor 5/8 type
	IPR001791	231	412	PS50025	Laminin G
	IPR001791	418	593	PS50025	Laminin G
	IPR000742	595	632	PS50026	EGF-like
	IPR001791	841	1006	PS50025	Laminin G
	IPR000742	1007	1045	PS50026	EGF-like
	IPR001791	1063	1175	PS50025	Laminin G
ScanRegExp	IPR000421	117	146	PS01285	Coagulation factor 5/8 type
	IPR000421	207	225	PS01286	Coagulation factor 5/8 type
	IPR001545	1006	1012	PS00261	Gonadotropin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	44	LAEVSMASVAWAVLKVLLLLPT	65	PRIMARY	22

Primer_f	TACCTTTCAGTTATCCTCGCC
Primer_r	GTTTGACTTCTGCATTTGTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TACCTTTCAGTTATCCTCGCC
Primer_r	GTTTGACTTCTGCATTTGTGG
PCR product length	189(1.6k) bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles