Order Kazusa clone(s) from : ![]() |
Product ID | ORK04596 |
---|---|
Accession No | AB020675 |
Description | contactin associated protein-like 2 |
Clone name | hk06919 |
Vector information | |
cDNA sequence | DNA sequence (4185 bp) Predicted protein sequence (1339 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0868
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 164 bp |
---|---|
Genome contig ID | gi89161213f_145344877 |
PolyA signal sequence (AATATA,-31) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (2398930 - 2398979) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 146167734 | 147743805 | 18 | 99.9 | Both No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000421 | 55 | 186 | PF00754 | Coagulation factor 5/8 type |
IPR012680 | 224 | 353 | PF02210 | Laminin G | |
IPR012680 | 409 | 537 | PF02210 | Laminin G | |
IPR006209 | 566 | 598 | PF00008 | EGF-like | |
IPR012680 | 835 | 953 | PF02210 | Laminin G | |
IPR012680 | 1063 | 1195 | PF02210 | Laminin G | |
HMMSmart | IPR000421 | 42 | 189 | SM00231 | Coagulation factor 5/8 type |
IPR001791 | 216 | 353 | SM00282 | Laminin G | |
IPR001791 | 401 | 537 | SM00282 | Laminin G | |
IPR006210 | 565 | 599 | SM00181 | EGF | |
IPR001791 | 827 | 953 | SM00282 | Laminin G | |
IPR006210 | 974 | 1010 | SM00181 | EGF | |
IPR001791 | 1055 | 1195 | SM00282 | Laminin G | |
IPR003585 | 1290 | 1308 | SM00294 | Neurexin/syndecan/glycophorin C | |
ProfileScan | IPR000421 | 43 | 189 | PS50022 | Coagulation factor 5/8 type |
IPR001791 | 195 | 376 | PS50025 | Laminin G | |
IPR001791 | 381 | 560 | PS50025 | Laminin G | |
IPR000742 | 562 | 599 | PS50026 | EGF-like | |
IPR001791 | 807 | 971 | PS50025 | Laminin G | |
IPR000742 | 972 | 1010 | PS50026 | EGF-like | |
IPR001791 | 1031 | 1222 | PS50025 | Laminin G | |
ScanRegExp | IPR000421 | 81 | 110 | PS01285 | Coagulation factor 5/8 type |
IPR000421 | 171 | 189 | PS01286 | Coagulation factor 5/8 type | |
IPR001545 | 971 | 977 | PS00261 | Gonadotropin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 14 | RAGCGAALLLWIVSSCLCRAWTA | 36 | SECONDARY | 23 | 2 | 1270 | AIIGGVIAVVIFTILCTLVFLIR | 1292 | PRIMARY | 23 |
---|
![]() |
Primer_f | TAATCCAGGACAAGGCCAAGC |
---|---|
Primer_r | GGTCTCTGTGAAGTTGGGGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |