| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK00844 | 
|---|---|
| Accession No | AB040898 | 
| Description | immunoglobulin superfamily containing leucine-rich repeat 2, transcript variant 2 | 
| Clone name | fh13187 | 
| Vector information | |
| cDNA sequence | DNA sequence (4815 bp) Predicted protein sequence (785 aa)  | 
| 
    
     
    HaloTag ORF Clone  | 
    
    
    
     
    FHC00844
     
     
     | 
| Flexi ORF Clone | FXC00844 | 
| Source | Human fetal brain | 
| Rouge ID | 
    mKIAA1465
    
    by Kazusa Mouse cDNA Project
     | 
| Note | We replaced fj00601, former representative clones for KIAA1465 with fh13187. (2002/5/10) | 
 Length: 4815 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning | 
 Integrity of 3' end
    | Length of 3'UTR | 1808 bp | 
|---|---|
| Genome contig ID | gi51511731f_72108768 | 
| PolyA signal sequence (AATAAA,-18)  | 
            +----*----+----*----+----*----+----  | 
        
| Flanking genome sequence (107428 - 107477)  | 
            ----+----*----+----*----+----*----+----*----+----*  | 
        
  
 Ensembl ContigView  (Add our DAS server as a DAS source)
  
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
| 
 | 15 | f | 72208768 | 72216194 | 4 | 100.0 | Perfect prediction | 
 
        Length: 785 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| FPrintScan | IPR001611 | 141 | 154 | PR00019 | Leucine-rich repeat | 
| IPR001611 | 162 | 175 | PR00019 | Leucine-rich repeat | |
| HMMPfam | IPR001611 | 92 | 114 | PF00560 | Leucine-rich repeat | 
| IPR001611 | 116 | 138 | PF00560 | Leucine-rich repeat | |
| IPR001611 | 140 | 162 | PF00560 | Leucine-rich repeat | |
| IPR001611 | 164 | 186 | PF00560 | Leucine-rich repeat | |
| IPR001611 | 188 | 210 | PF00560 | Leucine-rich repeat | |
| IPR000483 | 248 | 271 | PF01463 | Cysteine-rich flanking region | |
| IPR013098 | 281 | 412 | PF07679 | Immunoglobulin I-set | |
| HMMSmart | IPR003591 | 89 | 113 | SM00369 | Leucine-rich repeat | 
| IPR003591 | 114 | 137 | SM00369 | Leucine-rich repeat | |
| IPR003591 | 138 | 161 | SM00369 | Leucine-rich repeat | |
| IPR003591 | 162 | 185 | SM00369 | Leucine-rich repeat | |
| IPR003591 | 186 | 209 | SM00369 | Leucine-rich repeat | |
| IPR000483 | 221 | 271 | SM00082 | Cysteine-rich flanking region | |
| ProfileScan | IPR007110 | 273 | 411 | PS50835 | Immunoglobulin-like | 
	Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | GHNTCVYLAWAIFPALP | 17 | SECONDARY | 17 | 2 | 36 | ILGAAMFPLRALWLVWALLGVAG | 58 | PRIMARY | 23 | 3 | 633 | IVAVSVFLLVLATVPLLGAACCH | 655 | PRIMARY | 23 | 
|---|
           
	  RT-PCR-ELISA
	   | 
          
	  
 Experimental conditions| Primer_f | TGTTACACTGCATCGCCGACG | 
|---|---|
| Primer_r | GCGTCAGCAAATCCCCATCTC | 
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]()  | 
 Chromosome No. 15
 Experimental conditions| Panel name | CCR | 
|---|---|
| Primer_f | TGTTACACTGCATCGCCGACG | 
| Primer_r | GCGTCAGCAAATCCCCATCTC | 
| PCR product length | 162 bp | 
| PCR conditions | 95 °C 15 sec 66 °C 60 sec 30 cycles |