Order Kazusa clone(s) from : ![]() |
Product ID | ORK00470 |
---|---|
Accession No | D86983 |
Description | peroxidasin |
Clone name | ha02538 |
Vector information | |
cDNA sequence | DNA sequence (5510 bp) Predicted protein sequence (1496 aa) |
HaloTag ORF Clone |
FHC00470
![]() |
Flexi ORF Clone | FXC00470 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0230
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1019 bp |
---|---|
Genome contig ID | gi89161199r_1515964 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 1615964 | 1727285 | 23 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002007 | 782 | 793 | PR00457 | Haem peroxidase |
IPR002007 | 834 | 849 | PR00457 | Haem peroxidase | |
IPR002007 | 988 | 1006 | PR00457 | Haem peroxidase | |
IPR002007 | 1006 | 1026 | PR00457 | Haem peroxidase | |
IPR002007 | 1031 | 1057 | PR00457 | Haem peroxidase | |
IPR002007 | 1084 | 1094 | PR00457 | Haem peroxidase | |
IPR002007 | 1211 | 1231 | PR00457 | Haem peroxidase | |
IPR002007 | 1282 | 1296 | PR00457 | Haem peroxidase | |
HMMPfam | IPR001611 | 80 | 102 | PF00560 | Leucine-rich repeat |
IPR001611 | 104 | 126 | PF00560 | Leucine-rich repeat | |
IPR001611 | 128 | 150 | PF00560 | Leucine-rich repeat | |
IPR001611 | 152 | 174 | PF00560 | Leucine-rich repeat | |
IPR001611 | 176 | 198 | PF00560 | Leucine-rich repeat | |
IPR000483 | 236 | 261 | PF01463 | Cysteine-rich flanking region | |
IPR013098 | 263 | 350 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 359 | 446 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 450 | 536 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 542 | 628 | PF07679 | Immunoglobulin I-set | |
IPR002007 | 756 | 1309 | PF03098 | Haem peroxidase | |
IPR001007 | 1432 | 1487 | PF00093 | von Willebrand factor | |
HMMSmart | IPR003591 | 82 | 101 | SM00369 | Leucine-rich repeat |
IPR003591 | 102 | 125 | SM00369 | Leucine-rich repeat | |
IPR003591 | 126 | 149 | SM00369 | Leucine-rich repeat | |
IPR003591 | 150 | 173 | SM00369 | Leucine-rich repeat | |
IPR003591 | 174 | 197 | SM00369 | Leucine-rich repeat | |
IPR000483 | 209 | 261 | SM00082 | Cysteine-rich flanking region | |
IPR003599 | 269 | 353 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 275 | 341 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 365 | 447 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 371 | 436 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 456 | 537 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 462 | 526 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 548 | 629 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 554 | 618 | SM00408 | Immunoglobulin subtype 2 | |
IPR001007 | 1432 | 1487 | SM00214 | von Willebrand factor | |
ProfileScan | IPR007110 | 263 | 349 | PS50835 | Immunoglobulin-like |
IPR007110 | 359 | 445 | PS50835 | Immunoglobulin-like | |
IPR007110 | 450 | 537 | PS50835 | Immunoglobulin-like | |
IPR007110 | 538 | 627 | PS50835 | Immunoglobulin-like | |
IPR002007 | 746 | 1333 | PS50292 | Haem peroxidase | |
IPR001007 | 1430 | 1488 | PS50184 | von Willebrand factor | |
ScanRegExp | IPR001007 | 1451 | 1487 | PS01208 | von Willebrand factor |
Panel name | Genebridge 4 |
---|---|
Primer_f | CTTCATCCCATTGTGTATCTG |
Primer_r | AAGTTAGACAGTTCCCGACAC |
PCR product length | 162 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |