KIAA1039

Product ID	ORK05273
Accession No	AB028962
Description	RAP1 GTPase activating protein 2
Clone name	fh02337
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5446 bp) Predicted protein sequence (444 aa)
Source	Human fetal brain
Rouge ID	mKIAA1039 by Kazusa Mouse cDNA Project

Length: 5446 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4109 bp
Genome contig ID	gi51511734f_2741384
PolyA signal sequence (None)	+--------+--------+----*----+---- GCACATTGTATTTGTTAATGTACAAAACAAATTCT
Flanking genome sequence (146324 - 146373)	----+--------+--------+--------+--------+----* AAAAGGTTGACAAATGTATATTTTGTTGCTTAAATGTGTCTTTGCAGAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	2841384	2887706	15	99.2	Perfect prediction

Length: 444 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW90526	1.6e-160	100.0	GTPase activati...	Homo sapiens
EAW90528	1.6e-160	100.0	GTPase activati...	Homo sapiens
BAC85912	1.7e-160	100.0	unnamed protein...	Homo sapiens
NP_001093868	1.7e-160	100.0	GTPase activati...	Homo sapiens
Q684P5	1.8e-160	100.0	Rap1 GTPase-act...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007943	1.2e-42	55.4	KIAA0474
AB007900	1.1e-18	50.0	KIAA0440
AB037810	1.6e-18	49.7	KIAA1389
AB011117	2e-18	49.7	KIAA0545
AB033098	0.00024	31.2	KIAA1272

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000331	1	178	PF02145	Rap/ran-GAP
ProfileScan	IPR000331	1	178	PS50085	Rap/ran-GAP

Primer_f	GACTGCTGGCGTGTGAATGTG
Primer_r	ATCTACGAATCACCTCCTCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GACTGCTGGCGTGTGAATGTG
Primer_r	ATCTACGAATCACCTCCTCAC
PCR product length	127 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles