KIAA1389

Product ID	ORK06831
Accession No	AB037810
Description	signal-induced proliferation-associated 1 like 2
Clone name	hh03860
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5801 bp) Predicted protein sequence (1514 aa)
Source	Human adult brain
Rouge ID	mKIAA1389 by Kazusa Mouse cDNA Project

Length: 5801 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1159 bp
Genome contig ID	gi89161185r_230500337
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TTTTTTAATAAATGTTTAAAAGAAGTCCACATAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGGTGTTGTCAGGTGACTAGATTTTTTGTGATCTAACATGTCAACAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	230600337	230717112	22	99.9	Internal No-hit

Length: 1514 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAO12530	99.9	SPA-1-like 2 [H...	Homo sapiens
Q9P2F8	99.8	Signal-induced ...	Homo sapiens
XP_001151957	99.6	signal-induced ...	Pan troglodytes
AAI50335	100.0	SIPA1L2 protein...	Homo sapiens
XP_001493812	95.7	similar to SPA-...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007900	7.1e-154	54.3	KIAA0440
AB011117	2.2e-119	50.4	KIAA0545
AB007943	2e-22	36.8	KIAA0474
AB028962	1.8e-19	49.7	KIAA1039
AB033098	7.6e-05	29.2	KIAA1272

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000331	416	604	PF02145	Rap/ran-GAP
HMMPfam	IPR001478	742	814	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	751	817	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000331	387	604	PS50085	Rap/ran-GAP
ProfileScan	IPR001478	742	818	PS50106	PDZ/DHR/GLGF

Primer_f	AGCCAGCGGAACCACTTGTAC
Primer_r	CATCGTAGTGCAGGCCAAACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-