KIAA0545

Product ID	ORK06832
Accession No	AB011117
Description	signal-induced proliferation-associated 1 like 3
Clone name	hh00165s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6237 bp) Predicted protein sequence (1368 aa)
Source	Human adult brain
Rouge ID	mKIAA0545 by Kazusa Mouse cDNA Project
Note	We replaced hh00165, former representative clones for KIAA0545 with hh00165s1. (2002/5/10)

Length: 6237 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2129 bp
Genome contig ID	gi42406306f_43165284
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- TTCTGGAGGTTTCAAAGGAAATAAATGTTTCATAG
Flanking genome sequence (225564 - 225613)	----+--------+--------+--------+--------+----* AAATGGCTTGTGTGTTCACTTTTGGGGCAGCTGCCTGGAGTTGCTGACCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	f	43265284	43390846	20	99.6	Perfect prediction

Length: 1368 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60292	100.0	Signal-induced ...	Homo sapiens
AAI50621	100.0	Signal-induced ...	Homo sapiens
XP_524247	99.3	signal-induced ...	Pan troglodytes
XP_855409	93.9	similar to sign...	Canis lupus fam...
EDL24066	93.4	mCG122846 [Mus ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007900	5.1e-81	51.2	KIAA0440
AB037810	4.1e-80	50.2	KIAA1389
AB007943	3.2e-14	37.5	KIAA0474
AB028962	2.8e-12	49.7	KIAA1039

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000331	227	415	PF02145	Rap/ran-GAP
HMMPfam	IPR001478	553	625	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	562	628	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000331	198	415	PS50085	Rap/ran-GAP
ProfileScan	IPR001478	553	617	PS50106	PDZ/DHR/GLGF

Primer_f	CAGTTGTCTCCTCCCATCTTC
Primer_r	GCTGCTATCTTCGGCCATTGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAGTTGTCTCCTCCCATCTTC
Primer_r	GCTGCTATCTTCGGCCATTGG
PCR product length	177 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles