KIAA0216

Product ID	ORK01591
Accession No	D86970
Description	myosin XVIIIA, transcript variant 1
Clone name	hf00331s1
Vector information	The cDNA fragment was originally inserted at KpnI-NotI site ... The cDNA fragment was originally inserted at KpnI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGTACCGGTC CGGAATTCCC GGGTCGACCC ACGCGTCCG-5' end of cDNA.
cDNA sequence	DNA sequence (7597 bp) Predicted protein sequence (2067 aa)
HaloTag ORF Clone	FHC01591
Flexi ORF Clone	FXC01591
Source	Human adult brain
Rouge ID	mKIAA0216 by Kazusa Mouse cDNA Project
Note	We replaced ha04661, former representative clones for KIAA0216 with hf00331s1. (2002/12/27)

Length: 7597 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1251 bp
Genome contig ID	gi51511734r_24324663
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CGATGTATGGAAATAAAGGCCCTTTTCCTCCTGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCGCCAGTTTTCCTGCCTGTTCCTTCAGGCTCAGGCAAAGTCTGGATTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	24424663	24531556	41	99.9	Perfect prediction

Length: 2067 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92614	100.0	Myosin-XVIIIa; ...	Homo sapiens
EAW51184	99.6	hCG27198, isofo...	Homo sapiens
XP_001110808	99.2	similar to myos...	Macaca mulatta
XP_854225	96.2	similar to myos...	Canis lupus fam...
XP_001080824	94.7	similar to myos...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020673	1.1e-19	28.1	KIAA0866
AB111886	4.1e-19	26.5	KIAA2034
AB023217	6.2e-17	27.3	KIAA1000
AB040945	1.9e-12	28.2	KIAA1512
AB032945	7.9e-10	23.4	KIAA1119

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	1277	1620	PD360721	NULL
FPrintScan	IPR001609	448	467	PR00193	Myosin head
	IPR001609	504	529	PR00193	Myosin head
	IPR001609	550	577	PR00193	Myosin head
	IPR001609	803	831	PR00193	Myosin head
HMMPfam	IPR001478	233	321	PF00595	PDZ/DHR/GLGF
	IPR001609	420	628	PF00063	Myosin head
	IPR001609	652	726	PF00063	Myosin head
	IPR001609	766	854	PF00063	Myosin head
	IPR001609	1099	1186	PF00063	Myosin head
	IPR000048	1202	1222	PF00612	IQ calmodulin-binding region
HMMSmart	IPR001478	242	324	SM00228	PDZ/DHR/GLGF
	IPR001609	412	1199	SM00242	Myosin head
	IPR000048	1200	1222	SM00015	IQ calmodulin-binding region
ProfileScan	IPR001478	233	324	PS50106	PDZ/DHR/GLGF
	IPR001553	555	620	PS50163	RecA bacterial DNA recombination
	IPR000048	1201	1230	PS50096	IQ calmodulin-binding region

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	ACTTATCCCAGACACAACACC
Primer_r	CGGGTAAACAGGGGAGAGCAC
PCR product length	186 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles